Previous Contig 010057:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039P09Sequence521014873gb:AY062826_15654820.004Arabidopsis thaliana Unknown protein (At1g78810; F9K20.15) mRNA, complete cds.>g726010057 (2)
JMFF039P10Sequence533010057 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039P09+ CGAAGACGA
                      ____________________________________________________________
consensus CGAAGACGA
 
. : . : . : . : . : . :
rJMFF039P09+ GAAAGAGGAAGGCTCATCGAGCTTATGCAGAGTCTATTTGTCAGATATTTGGATGGGACA
                      ____________________________________________________________
consensus GAAAGAGGAAGGCTCATCGAGCTTATGCAGAGTCTATTTGTCAGATATTTGGATGGGACA
 
. : . : . : . : . : . :
rJMFF039P09+ TCAATAAGTTCATTCAGTCTTCGGATAAATCTGCTGAGGCTCAGGGTAACATTGACAAAT
                      ____________________________________________________________
consensus TCAATAAGTTCATTCAGTCTTCGGATAAATCTGCTGAGGCTCAGGGTAACATTGACAAAT
 
. : . : . : . : . : . :
rJMFF039P09+ CTGGTAAAGATGGCTTGGACCTCCCTTGTGATACTGTGGACCTTGTGAAAGTTGATACTG
                      ____________________________________________________________
consensus CTGGTAAAGATGGCTTGGACCTCCCTTGTGATACTGTGGACCTTGTGAAAGTTGATACTG
 
. : . : . : . : . : . :
rJMFF039P09+ GAAATGAGAAAATCAAAAGTGGTAGTGGATCTGAGCACAATTCATTGGCTGAAGTTGACA
rJMFF039P10+ AATCANAAGTGGTAGTGGATNTGAGCACAATTCATGGGNNGAAGTTGNCA
                      ____________________________________________________________
consensus GAAATGAGAAAATCAAAAGTGGTAGTGGATCTGAGCACAATTCATTGGCTGAAGTTGACA
 
. : . : . : . : . : . :
rJMFF039P09+ CTAGCAAACATGTTGAAGTTCTCAGTGGTGATGTTCAAGATGCAGAAACTGTGAATGCAG
rJMFF039P10+ NTAGCAAACATGTTGAAGTTCTCAGTGGTGATGNTCAAGATGCAGAAGCNGTGAATGCAG
                      ____________________________________________________________
consensus CTAGCAAACATGTTGAAGTTCTCAGTGGTGATGTTCAAGATGCAGAAGCTGTGAATGCAG
 
. : . : . : . : . : . :
rJMFF039P09+ AGCGCTCGCCAAATGGCCCGGAGCCTGCAAACGTGCATTGTGATGTTGCACATGGAAAGG
rJMFF039P10+ AGCGCTCGCCAAATGGCCCGGAGCCTGCAANCGTGCATNGTGATGTTGCNCATGGAAAGG
                      ____________________________________________________________
consensus AGCGCTCGCCAAATGGCCCGGAGCCTGCAAACGTGCATTGTGATGTTGCACATGGAAAGG
 
. : . : . : . : . : . :
rJMFF039P09+ ATCATCAAGAGGATAATGTTCCCAATGACCTCAAGGAAGATGGTGTTCAGAACTGACCAG
rJMFF039P10+ ATCATCAAGAGGATAATGTTCCCAATGACNTCAAGGAAGATGGTGTTCAGANNTGNCCAG
                      ____________________________________________________________
consensus ATCATCAAGAGGATAATGTTCCCAATGACCTCAAGGAAGATGGTGTTCAGAACTGACCAG
 
. : . : . : . : . : . :
rJMFF039P09+ GAAAAGATGTTGACCCACTTAACCATGAATCCAAGATTAGTTTTCTTAGCTCTCACCCCA
rJMFF039P10+ GAAAAGATGNNGACCCANTTAACCATGAATCCAAGANTAGTTTTATTAGCTCTCACCCCA
                      ____________________________________________________________
consensus GAAAAGATGTTGACCCACTTAACCATGAATCCAAGATTAGTTTTCTTAGCTCTCACCCCA
 
. : . : . : . : . : . :
rJMFF039P09+ GACATGCTTGTTAGTTCTCGCATTTAGCAAGTGTTAATAGTCTAAGAATTGATATTCGTA
rJMFF039P10+ GNCATGCTTGTTAGTTNTCGCATTTAGCAAGTGTTAATAGTGTAAGAATTGATATTCGTA
                      ____________________________________________________________
consensus GACATGCTTGTTAGTTCTCGCATTTAGCAAGTGTTAATAGTGTAAGAATTGATATTCGTA
 
. : . : . : . : . : . :
rJMFF039P09+ GTATTTCTCTGTGTTGTGCTGGAAATGTTGATGTGAATGACGTTGAACCAGCCTTTCCGA
rJMFF039P10+ GTATTTCTCTGTGTTGTGCTGGAAATGNTGATGTGAACGACGTTGAACCAGCCTTTCNGA
                      ____________________________________________________________
consensus GTATTTCTCTGTGTTGTGCTGGAAATGTTGATGTGAATGACGTTGAACCAGCCTTTCCGA
 
. : . : . : . : . : . :
rJMFF039P09+ GGATCTGGCAGTTGAAGTTTAGAAGCGCATGATTGTATCCAAGGTTGGTTTTCTTAGTTC
rJMFF039P10+ GGATCTGGCAGCTGAAGTTTAGAAGCGCATGATTGTATCCAAGGNTGGTTTTCTTAGTTC
                      ____________________________________________________________
consensus GGATCTGGCAGTTGAAGTTTAGAAGCGCATGATTGTATCCAAGGTTGGTTTTCTTAGTTC
 
. : . : . : . : . : . :
rJMFF039P09+ TTATCCCAGACATGCTTGTTAGTTTTCTCTGATGGCAAGTGTTAGTAGTCTGAGAAT
rJMFF039P10+ TTATCCCAGACATGCTTGTTAGTNTTCTCTGATGGCAAGTGTTAGTAGTCTGAGAATNGA
                      ____________________________________________________________
consensus TTATCCCAGACATGCTTGTTAGTTTTCTCTGATGGCAAGTGTTAGTAGTCTGAGAATNGA