Previous Contig 010048:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005O07Sequence357010048 (6)pir|H96589|H965895e-17hypothetical protein T22H22.19 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMFF039N09Sequence518010048 (6)pir|H96589|H965894e-32hypothetical protein T22H22.19 [imported] - Arabidopsis thaliana>gb:AE005173_893703010048 (6)gb:AC135418_17422269e-88Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0035J16, complet
JMSF013F14Sequence575010048 (6)pir|H96589|H965892e-48hypothetical protein T22H22.19 [imported] - Arabidopsis thaliana>gb:AE005173_893680010048 (6)gb:AC135418_17422268e-93Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0035J16, complet
JMSF044L13Sequence785010048 (6)gb:AC135418_17422262e-92Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0035J16, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF005O07- GTTACTGTTCAAATGGAGA
JMFF039N09- ATTCTTGATTTGTTACTGTTCAAATGGAGA
JMSF013F14- GTTACTGTTCAAATGGAGA
                      ____________________________________________________________
consensus ATTCTTGATTTGTTACTGTTCAAATGGAGA
 
. : . : . : . : . : . :
JMFF005O07- CCCTTCTCTCCACTCCATCTTTCTGTCCACTCTTCAATCCCAAACCTTCAAGACCTTCAC
JMFF039N09- CCCTTCTCTCCACTCCATCTTTCTGTCCACTCTTCAATCCCAAACCTTCAAGACCTTCAC
JMSF013F14- CCCTTCTCTCCACTCCATCTTTCTGTCCACTCTTCAATCCCAAACCTTCAAGACCTTCAC
                      ____________________________________________________________
consensus CCCTTCTCTCCACTCCATCTTTCTGTCCACTCTTCAATCCCAAACCTTCAAGACCTTCAC
 
. : . : . : . : . : . :
JMFF005O07- TTTCTTCCCAACACAGATCAAATTTTCTCACTTTACCAAAACCCCTTTCTTGCAGCCTCA
JMFF039N09- TTTCTTCCCAACACAGATCAAATTTTCTCACTTTACCAAAACCCCTTTCTTGCAGCCTCA
JMSF013F14- TTTCTTCCCAACACAGATCAAATTTTCTCACTTTACCAAAACCCCTTTCTTGCAGCCTCA
                      ____________________________________________________________
consensus TTTCTTCCCAACACAGATCAAATTTTCTCACTTTACCAAAACCCCTTTCTTGCAGCCTCA
 
. : . : . : . : . : . :
JMFF005O07- GAAGAGAGCATTCTCTGCCTGAAAGACAACATCTTTCTCTACCCAAAACATGGATTTCCC
JMFF039N09- GAAGAGAGCATTCTCTGCCTGAAAGACAACATCTTTCTCTACCCAAAACATGGATTTCCC
JMSF013F14- GAAGAGAGCATTCTCTGCCTGAAAGACAACATCTTTCTCTACCCAAAACATGGATTTCCC
rJMSF044L13+ AAAACATGGATTTCCC
                      ____________________________________________________________
consensus GAAGAGAGCATTCTCTGCCTGAAAGACAACATCTTTCTCTACCCAAAACATGGATTTCCC
 
. : . : . : . : . : . :
JMFF005O07- ATGTCCATCAAGGCCTAGCTGCCCTTGCCATTTCTCTTGCTCTCAATTTCTGCCCTG-TT
JMFF039N09- ATGTCCATCAAGGCCTAGCTGCCCTTGCCATTTCTCTTGCTCTCAATTTCTGCCCTG-TT
JMSF013F14- ATGTCCATCAAGGCCTAGCTGCCCTTGCCATTTCTCTTGCTCTCAATTTCTGCCCTG-TT
rJMSF044L13+ ATGTCCATCAAGGCCTAGCTGCCCTTGCCATTTCTCTTGCTCTCAATTTCTGCCCTGTTT
                      ____________________________________________________________
consensus ATGTCCATCAAGGCCTAGCTGCCCTTGCCATTTCTCTTGCTCTCAATTTCTGCCCTG-TT
 
. : . : . : . : . : . :
JMFF005O07- TTGCCCTCTGCTTCTGCACTGGCATCTGAGTTTGATGTTCTTAATGAAGG-CCCACCCAA
JMFF039N09- TTGCCCTCTGCTTCTGCACTGGCATCTGAGTTTGATGTTCTTAATGAAGG-CCCACCCAA
JMSF013F14- TTGCCCTCTGCTTCTGCACTGGCATCTGAGTTTGATGTTCTTAATGAAGG-CCCACCCAA
rJMSF013F14+ TTCTGCACTGGCATCTGAGTTTGATGTTCTTAATGAAGG-CCCACCCAA
rJMSF044L13+ TTGCCCTCTGCTTCTGCACTGGCATCTGAGTTTGATGTTCTTAATGAAGG-CCCACCCAA
rJMFF039N09+ TCTGCACTGGCATCTGAGTTTGATGTTCTTAATGAAGGCCCCACCCAA
                      ____________________________________________________________
consensus TTGCCCTCTGCTTCTGCACTGGCATCTGAGTTTGATGTTCTTAATGAAGG-CCCACCCAA
 
. : . : . : . : . : . :
JMFF005O07- GGAATCTTAT-GTTGTTGATGATGCTGGGGTCCTTA
JMFF039N09- GGAATCTTATGGTTGTTGATGATGCTGGGGTCCTTAGCCGGGTCACACGATCCGATTTGA
JMSF013F14- GGAATCTTAT-GTTGTTGATGATGCTGGGGTCCTTAGCCGGGTCACACGATCCGATTTGA
rJMSF013F14+ GGAATCTTAT-GTTGTTGATGATGCTGGGGTCCTTAGCCGGGTCACACGATCCGATTTGA
rJMSF044L13+ GGAATCTTAT-GTTGTTGATGATGCTGGGGTCCTTAGCCGGGTCACACGATCCGATTTGA
rJMFF039N09+ GGAATCTTAT-GTTGTTGATGATGCTGGGGTCNTTAGCCGGGTCACACGATCCGATTTGA
                      ____________________________________________________________
consensus GGAATCTTAT-GTTGTTGATGATGCTGGGGTCCTTAGCCGGGTCACACGATCCGATTTGA
 
. : . : . : . : . : . :
JMFF039N09- GGCGATTGTTGGAGGATTTGGAGTTCAGGAAAGGCTACCACATTAACTTCGTCACTGTCC
JMSF013F14- GGCGATTGTTGGAGGATTTGGAGTTCAGGAAAGGCTACCACATTAACTTCGTCACTGTCC
rJMSF013F14+ GGCGATTGTTGGAGGATTTGGAGTTCAGGAAAGGCTACCACATTAACTTCGTCACTGTCC
rJMSF044L13+ GGCGATTGTTGGAGGATTTGGAGTTCAGGAAAGGCTACCACATTAACTTCGTCACTGTCC
rJMFF039N09+ GGCGATTGTTGGAGGATTTGGAGTTCAGGAAAGGCTACCACATTAACTTCGTCACTGTCC
                      ____________________________________________________________
consensus GGCGATTGTTGGAGGATTTGGAGTTCAGGAAAGGCTACCACATTAACTTCGTCACTGTCC
 
. : . : . : . : . : . :
JMFF039N09- GCAAGCTTACTAGCAAGGCTGATGCGTTTGAGTATGCTGACCAAGTTTTGGAGCGTTGGT
JMSF013F14- GCAAGCTTACTAGCAAGGCTGATGCGTTTGAGTATGCTGACCAAGTTTTGGAGCGTTGGT
rJMSF013F14+ GCAAGCTTACTAGCAAGGCTGATGCGTTTGAGTATGCTGACCAAGTTTTGGAGCGTTGGT
rJMSF044L13+ GCAAGCTTACTAGCAAGGCTGATGCGTTTGAGTATGCTGACCAAGTTTTGGAGCGTTGGT
rJMFF039N09+ GCAAGCTTACTAGCAAGGCTGATGCGTTTGAGTATGCTGACCAAGTTTTGGAGCGTTGGT
                      ____________________________________________________________
consensus GCAAGCTTACTAGCAAGGCTGATGCGTTTGAGTATGCTGACCAAGTTTTGGAGCGTTGGT
 
. : . : . : . : . : . :
JMFF039N09- ATCCCACGGT
JMSF013F14- ATCCCACGGTTGAGGAAGGTAGCAATAAGGGCATAGTCGTGCTGGTAACGAGTCAGAAGG
rJMSF013F14+ ATCCCACGGTTGAGGAAGGTAGCAATAAGGGCATAGTCGTGCTGGTAACGAGTCAGAAGG
rJMSF044L13+ ATCCCACGGTTGAGGAAGGTAGCAATAAGGGCATAGTCGTGCTGGTAACGAGTCAGAAGG
rJMFF039N09+ ATCCCACGGTTGAGGAAGGTAGCAATAAGGGCATAGTCGTGCTGGTAACGAGTCAGAAGG
                      ____________________________________________________________
consensus ATCCCACGGTTGAGGAAGGTAGCAATAAGGGCATAGTCGTGCTGGTAACGAGTCAGAAGG
 
. : . : . : . : . : . :
JMSF013F14- AAGGGGCAATCACGGGTG
rJMSF013F14+ AAGGGGCAATCACGGGTGGACCTGAATTTGTGAAGGCAGTTGGTGACACTATTCTTGATG
rJMSF044L13+ AAGGGGCAATCACGGGTGGACCTGAATTTGTGAAGGCAGTTGGTGACACTATTCTTGATG
rJMFF039N09+ AAGGGGCAATCACGGGTGGACCTGAATTTGTGAAGGCAGTTGGTGACACTATTCTTGATG
                      ____________________________________________________________
consensus AAGGGGCAATCACGGGTGGACCTGAATTTGTGAAGGCAGTTGGTGACACTATTCTTGATG
 
. : . : . : . : . : . :
rJMSF013F14+ CTACGGTTTCAGAGAACCTCCCAGTCTTGGCAACTGAGGAGAAGTACAACGAAGCAGTCT
rJMSF044L13+ CTACGGTTTCAGAGAACCTCCCAGTCTTGGCAACTGAGGAGAAGTACAACGAAGCAGTCT
rJMFF039N09+ CTACGGTTTCAGAGAACCTCCCAGTCTTGGCAACTGAGGAGAAGTACAACGAAGCAGTCT
                      ____________________________________________________________
consensus CTACGGTTTCAGAGAACCTCCCAGTCTTGGCAACTGAGGAGAAGTACAACGAAGCAGTCT
 
. : . : . : . : . : . :
rJMSF013F14+ ACAGCACTGCCAAGCGCCTCGTTGCTGCCATCGATGGGCTTCCTGACCCTGGTGGGCCCG
rJMSF044L13+ ACAGCACTGCCAAGCGCCTCGTTGCTGCCATCGATGGGCTTCCTGACCCTGGTGGGCCCG
rJMFF039N09+ ACAGCACTGCCAAGCGCCTCGTTGCTGCCATCGATGGGCTTCCTGACCCTGGTGGGCCCG
                      ____________________________________________________________
consensus ACAGCACTGCCAAGCGCCTCGTTGCTGCCATCGATGGGCTTCCTGACCCTGGTGGGCCCG
 
. : . : . : . : . : . :
rJMSF013F14+ TGTTCAAGGACAACAAGCGAGAATCCAACTTCAAAACCAAAGAGGAGACGGAAGAGAAAA
rJMSF044L13+ TGTTCAAGGACAACAAGCGAGAATCCAACTTCAAAACCAAAGAGGAGACGGAAGAGAAAA
rJMFF039N09+ TGTTCAAGGACAACAAGCGAGAATCCAACTTCAAAACCAAAGAGGAGACGGAAGAGAAAA
                      ____________________________________________________________
consensus TGTTCAAGGACAACAAGCGAGAATCCAACTTCAAAACCAAAGAGGAGACGGAAGAGAAAA
 
. : . : . : . : . : . :
rJMSF013F14+ GAGGGCAGTTTTCACTTGTAGTTGGCGGTTTGTTAGTGATTGCTTTTGTTGTTCCAATGG
rJMSF044L13+ GAGGGCAGTTTTCACTTGTAGTTGGCGGTTTGTTAGTGATTGCTTTTGTTGTTCCAATGG
rJMFF039N09+ GAGGGCAGTTTTCACTTGTAGTTGGCGGTTTGTTAGTGATTGCTTTTGTTGTTCCAATGG
                      ____________________________________________________________
consensus GAGGGCAGTTTTCACTTGTAGTTGGCGGTTTGTTAGTGATTGCTTTTGTTGTTCCAATGG
 
. : . : . : . : . : . :
rJMSF013F14+ CACAATATTATGCGTATGTTTCCAAGAAATG-AACTGTAGTATCGATGTTCCCTGTGACT
rJMSF044L13+ CACAATATTATGCGTATGTTTCCAAGAAATGAAACTGTAGTATCGATGTT-CCTGTGACT
rJMFF039N09+ CACAATATTATGCGTATGTTTCCAAGAAATG-AACTGTAGTATCGATGTT-CCTGTGACT
                      ____________________________________________________________
consensus CACAATATTATGCGTATGTTTCCAAGAAATG-AACTGTAGTATCGATGTT-CCTGTGACT
 
. : . : . : . : . : . :
rJMSF013F14+ TGAGT-AAACATGGATACACTCTC
rJMSF044L13+ TGAGTAAAACATGGATACACTCTCAGTGTACCAAATTGTGATTTGG
rJMFF039N09+ TGAGT-AAACATGGATACACTCTCAGTGTA-CAAATTGTGATTTGGGAAATAAATAATTC
                      ____________________________________________________________
consensus TGAGT-AAACATGGATACACTCTCAGTGTACCAAATTGTGATTTGGGAAATAAATAATTC