Previous Contig 010047:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039N07Sequence590014869gb:AB104614_15265020.022Daucus carota C-HAP2B mRNA for CCAAT-box binding factor HAP2 homolog, complete c736010047 (2)gb:AF220405_17782717e-18Vitis riparia transcription factor (Rev136-2) mRNA, complete cds.
JMSF037P01Sequence255010047 (2)gb:AF220405_17782714e-15Vitis riparia transcription factor (Rev136-2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039N07+ AAATGGAGGAGGAGCC
                      ____________________________________________________________
consensus AAATGGAGGAGGAGCC
 
. : . : . : . : . : . :
rJMSF037P01+ TACGTCAACGCGAAACAATATAATGGGATTTTAAGGCGAAGGCGGGTTAGAGCTAA
rJMFF039N07+ TGTNTACGTCAACGCGAAACAATATAATGGGATTTTAAGGCGAAGGCGGGTTAGAGCTAA
                      ____________________________________________________________
consensus TGTNTACGTCAACGCGAAACAATATAATGGGATTTTAAGGCGAAGGCGGGTTAGAGCTAA
 
. : . : . : . : . : . :
rJMSF037P01+ AGCAGAACTTGAAAAGAAAGCCATCAAAGCCAGACGGCCATATCTTCATGAATCTCGCCA
rJMFF039N07+ AGCAGAACTTGAAAAGAAAGCCATCAAAGCCAGACGGCCATATCTTCATGAATCTCGCCA
                      ____________________________________________________________
consensus AGCAGAACTTGAAAAGAAAGCCATCAAAGCCAGACGGCCATATCTTCATGAATCTCGCCA
 
. : . : . : . : . : . :
rJMSF037P01+ TCAACATGCACTGAGGAGGGAAAGGGGGTCGGGGGGCCGATTTCTCAATACAAAAAAGCT
rJMFF039N07+ TCAACATGCACTGAGGAGGGAAAGGGGGTCGGGGGGCCGATTTCTCAATACAAAAAAGCT
                      ____________________________________________________________
consensus TCAACATGCACTGAGGAGGGAAAGGGGGTCGGGGGGCCGATTTCTCAATACAAAAAAGCT
 
. : . : . : . : . : . :
rJMSF037P01+ AAATGATATGAATTCGAAAACAGACGAGCATACGCAATCTGGTGCAACTGCTACAACAAA
rJMFF039N07+ AAATGATATGAATTCGAAAACAGACGAGCATACGCAATCTGGTGCAACTGCTACAACAAA
                      ____________________________________________________________
consensus AAATGATATGAATTCGAAAACAGACGAGCATACGCAATCTGGTGCAACTGCTACAACAAA
 
. : . : . : . : . : . :
rJMFF039N07+ CTCGGGCCACTCATCGGGTTCAGAGCATTTGTGTACGAACAGCGAAGGGCAGTCTGCTGT
                      ____________________________________________________________
consensus CTCGGGCCACTCATCGGGTTCAGAGCATTTGTGTACGAACAGCGAAGGGCAGTCTGCTGT
 
. : . : . : . : . : . :
rJMFF039N07+ AAAAGAAATGTGCAGAGCAGACAGCCATGGCTTCCCATCGGTGCATTTTACAGAGTCGAG
                      ____________________________________________________________
consensus AAAAGAAATGTGCAGAGCAGACAGCCATGGCTTCCCATCGGTGCATTTTACAGAGTCGAG
 
. : . : . : . : . : . :
rJMFF039N07+ CGGGAATGAAAAGGGAAGTTTTCGTCATGGTCATCAAAACTGGAGCTTTATGGGAAACCA
                      ____________________________________________________________
consensus CGGGAATGAAAAGGGAAGTTTTCGTCATGGTCATCAAAACTGGAGCTTTATGGGAAACCA
 
. : . : . : . : . : . :
rJMFF039N07+ GGCTCCTCACGGTGCGCCACCCAGCAATTGAAAACTCGTTCCTGTGTAATGGAGGGGTAA
                      ____________________________________________________________
consensus GGCTCCTCACGGTGCGCCACCCAGCAATTGAAAACTCGTTCCTGTGTAATGGAGGGGTAA
 
. : . : . : . : . : . :
rJMFF039N07+ GACAATCCATCCCTTCTTACACGGGTCTGGCAATTCATTCTTGGCTTGTTTTACCTATGT
                      ____________________________________________________________
consensus GACAATCCATCCCTTCTTACACGGGTCTGGCAATTCATTCTTGGCTTGTTTTACCTATGT
 
. : . : . : . : . : . :
rJMFF039N07+ GGGCAAGATGGGTAGAAACGAATAGACTCGGGCTGTGTCGGTCAGCCATTTGTTTCTATT
                      ____________________________________________________________
consensus GGGCAAGATGGGTAGAAACGAATAGACTCGGGCTGTGTCGGTCAGCCATTTGTTTCTATT
 
. : . : . : . : . : . :
rJMFF039N07+ GCTTCTTCCCAGTGTTGTAGATATATGCTCTGATATATAGACTGAGAAGTTGTAGTGTGA
                      ____________________________________________________________
consensus GCTTCTTCCCAGTGTTGTAGATATATGCTCTGATATATAGACTGAGAAGTTGTAGTGTGA
 
. : . : . : . : . : . :
rJMFF039N07+ TTATTTTGTGGTTGGCTTACCACAAAAAAGATAGTGGTGTTGAACTTATAGACAACAAAC
                      ____________________________________________________________
consensus TTATTTTGTGGTTGGCTTACCACAAAAAAGATAGTGGTGTTGAACTTATAGACAACAAAC