Previous Contig 010045:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002L09Sequence577010045 (25)gb:AP005764_18574714e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN611010045 (25)gb:AP005764_18574714e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF006O02Sequence460010045 (25)gb:AP005764_18574711e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN628010045 (25)gb:AP005764_18574713e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF026N24Sequence489010045 (25)gb:AP005764_18574713e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN648010045 (25)gb:AP005764_18574712e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF035E13Sequence577010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN566010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF039N04Sequence571010045 (25)gb:AP005764_18574719e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN665010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF045H01Sequence639010045 (25)gb:AP005764_18574717e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN483010045 (25)gb:AP005764_18574712e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF046G04Sequence557010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN563010045 (25)gb:AP005764_18574714e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF047C01Sequence445010045 (25)gb:AP003703_18321281e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10323010045 (25)gb:AP005764_18574715e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFN011A14Sequence601010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFN029L17Sequence565010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFN038P05Sequence611010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFS066F07Sequence620010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFS076G12Sequence627010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMSF028L14Sequence639010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN592010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMSF029F19Sequence644010045 (25)gb:AP005764_18574712e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN600010045 (25)gb:AP005764_18574711e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045H01- ATTTTTTAGGAAACAATTTTTAATATTAAAA
JMSF028L14+ GGAAACAATTTTTAATATTAAAA
JMFS076G12+ AATTTTTAATATTAAAA
JMFS066F07+ AATATTAAAA
JMFN029L17+ TTTTTAATA-TAAAA
JMFN038P05+ GGAAACAATTTTTAATATTAAAA
rJMFF046G04- AGGAAACAATTTTTAATATTAAAA
rJMFF047C01- AGGAAACAATTTTTAATATTAAAA
JMSF029F19+ AGGAAACAATTTTTAATATTAAAA
JMFF045H01+ TTTTAATATTAAAA
rJMFF026N24- AA
rJMFF006O02- AA
rJMFF039N04- TATTAAAA
                      ____________________________________________________________
consensus ATTTTTTAGGAAACAATTTTTAATATTAAAA
 
. : . : . : . : . : . :
rJMFF045H01- CTTCGTAATATCCACCAGAATGGTTCTTTGAACTATCAAAACCTTAATGTCCTCCAAAAC
rJMSF028L14- TGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMSF028L14+ CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMFS076G12+ CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
rJMFF002L09- AATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMFS066F07+ CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
rJMFF035E13- ATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTATTCCAAAAC
JMFN029L17+ CTCG-AAATATCCACCAGATTGG-TCTTTGAACTATCAAAAACTTAGTGT-GTCCAAAAC
JMFN038P05+ CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
rJMSF029F19- TTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMFF002L09+ ATCAAAAACTTAGTGTTTTCCAAAAC
rJMFF046G04- CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
rJMFF047C01- CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMSF029F19+ CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMFF045H01+ CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMFN011A14+ GTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGT-TTCCAAAAC
JMFF035E13+ ATCAAAAACTTAGTGTATTCCAAAAC
rJMFF026N24- CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
rJMFF006O02- CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
JMFF039N04+ TTTCCAAAAC
rJMFF039N04- CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
                      ____________________________________________________________
consensus CTCGTAAATATCCACCAGATTGGTTCTTTGAACTATCAAAAACTTAGTGTTTTCCAAAAC
 
. : . : . : . : . : . :
rJMFF045H01- GGGCTTTTCCCCTATCACTAAATATAAGACTGCCAAAACACAATCATACCGCTAGGCTCT
rJMSF028L14- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMSF028L14+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFS076G12+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
rJMFF002L09- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFS066F07+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
rJMFF035E13- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFN029L17+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFN038P05+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
rJMSF029F19- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFF002L09+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
rJMFF046G04- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
rJMFF047C01- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMSF029F19+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFF045H01+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFN011A14+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGTTAGGCACT
JMFF035E13+ AAGCTAAACCCAAATCANTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
rJMFF026N24- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
rJMFF006O02- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFF039N04+ AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
JMFF046G04+ CTGCAAGAAGACAATCATATTGCTAGGCACT
rJMFF039N04- AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
                      ____________________________________________________________
consensus AAGCTAAACCCAAATCACTAAAGATAAAACTGCAAGAAGACAATCATATTGCTAGGCACT
 
. : . : . : . : . : . :
rJMFF045H01- TAATGAGATTTCACAAAGACTTGAACTACGCGGAGGCCTTCAG-CTCCTCTCCAAAATCC
rJMSF028L14- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMSF028L14+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFS076G12+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
rJMFF002L09- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCCTCAGTCTCCTCTCCAAAATCC
JMFS066F07+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
rJMFF035E13- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFN029L17+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFN038P05+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
rJMSF029F19- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFF002L09+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCCTCAGTCTCCTCTCCAAAATCC
rJMFF046G04- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
rJMFF047C01- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMSF029F19+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFF045H01+ TAGTGAGATNTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFN011A14+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFF035E13+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
rJMFF026N24- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
rJMFF006O02- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFF039N04+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFF046G04+ TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
JMFF026N24+ CTTCAGTCTCCTCTCCAAAATCC
JMFF006O02+ CCTCTCCAAAATCC
rJMFF039N04- TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
                      ____________________________________________________________
consensus TAGTGAGATTTCACATAGTCTTGAACAACGTGGAGGCCTTCAGTCTCCTCTCCAAAATCC
 
. : . : . : . : . : . :
rJMFF045H01- TTAACAACGAGGAAGGAGCATCCCACCACCTTCCAAGC-TTTGCCCTCGGAATCAAACTT
rJMSF028L14- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMSF028L14+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFS076G12+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
rJMFF002L09- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGCTTTTGCCCTCGGAATCAATCTT
JMFS066F07+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
rJMFF035E13- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFN029L17+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFN038P05+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
rJMSF029F19- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF002L09+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGCTTTTGCCCTCGGAATCAATCTT
rJMFF046G04- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
rJMFF047C01- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMSF029F19+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF045H01+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFN011A14+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF035E13+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
rJMFF026N24- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
rJMFF006O02- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF039N04+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF046G04+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF026N24+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF006O02+ TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
JMFF047C01+ CAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
rJMFF039N04- TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
                      ____________________________________________________________
consensus TTTACAACGACGCAAGAGCATCCAACAACCTTCCTAGC-TTTGCCCTCGGAATCAATCTT
 
. : . : . : . : . : . :
rJMFF045H01- GCCCAGACCGGTCCATTCTTCAACGGCCTTTGCGCTATGAACTGTAATCACGTTGACATT
rJMSF028L14- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMSF028L14+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFS076G12+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMFF002L09- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFS066F07+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMFF035E13- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFN029L17+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFN038P05+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMSF029F19- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFF002L09+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMFF046G04- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMFF047C01- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMSF029F19+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFF045H01+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFN011A14+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFF035E13+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMFF026N24- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMFF006O02- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFF039N04+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAACCAGGTTGACATT
JMFF046G04+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFF026N24+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFF006O02+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
JMFF047C01+ GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
rJMFF039N04- GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAACCAGGTTGACATT
                      ____________________________________________________________
consensus GCACAGACCGGCCCATTCACCAAGGGTCTTTGCGCTAGGAACTGTAATCAGGTTGACATT
 
. : . : . : . : . : . :
rJMFF045H01- GGGGTCATTACAAAGTGGATTGACCAATTTGACAAAGTCGGGGTGATCACAGACCTCATT
rJMSF028L14- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCGGC
JMSF028L14+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCGGC
JMFS076G12+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
rJMFF002L09- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFS066F07+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
rJMFF035E13- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFN029L17+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFN038P05+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
rJMSF029F19- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF002L09+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
rJMFF046G04- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMSF029F19+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF045H01+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFN011A14+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF035E13+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
rJMFF026N24- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
rJMFF006O02- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF039N04+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF046G04+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF026N24+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF006O02+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
JMFF047C01+ GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
rJMFF039N04- GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
                      ____________________________________________________________
consensus GTGGTCATTACAAAGTGCTTTGACCAATTTAACATAGTCAGGCTGATCACAGTCCTCAGC
 
. : . : . : . : . : . :
rJMFF045H01- CACCACACATAGTTGGGCTGGATGTTTCTCAATCACCTTAACACCTTCATGAAGGGCTTT
rJMSF028L14- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMSF028L14+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFS076G12+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
rJMFF002L09- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFS066F07+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
rJMFF035E13- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFN029L17+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFN038P05+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
rJMSF029F19- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF002L09+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
rJMFF046G04- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMSF029F19+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF045H01+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFN011A14+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF035E13+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
rJMFF026N24- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
rJMFF006O02- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF039N04+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF046G04+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF026N24+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF006O02+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
JMFF047C01+ CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
rJMFF039N04- CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
                      ____________________________________________________________
consensus CAGCACACATAGTTGGGCTGCATGTTTCTCAATCACCTTAGCACCTTCATGAAGGCCTTT
 
. : . : . : . : . : . :
rJMFF045H01- TGGCATCCCACCATGATTCAGGGATTTCCTCAG
rJMSF028L14- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMSF028L14+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFS076G12+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
rJMFF002L09- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFS066F07+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
rJMFF035E13- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFN029L17+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFN038P05+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
rJMSF029F19- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF002L09+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
rJMFF046G04- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMSF029F19+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF045H01+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFN011A14+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF035E13+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
rJMFF026N24- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
rJMFF006O02- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF039N04+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF046G04+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF026N24+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF006O02+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
JMFF047C01+ TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
rJMFF039N04- TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
                      ____________________________________________________________
consensus TGCCAGCCCACCATGAGCCAGGGATTTCCTCAGCACAAGCTGCAATGCAGTCATTACATC
 
. : . : . : . : . : . :
rJMSF028L14- CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMSF028L14+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFS076G12+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
rJMFF002L09- CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFS066F07+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
rJMFF035E13- CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCANGTGTCTCTGTAACATCTTCACT
JMFN029L17+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFN038P05+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
rJMSF029F19- CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF002L09+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
rJMFF046G04- CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAACAAGTGTCTCTGTAACATCTTCACT
JMSF029F19+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF045H01+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFN011A14+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF035E13+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
rJMFF026N24- CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
rJMFF006O02- CATGGGGTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF039N04+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF046G04+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF026N24+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF006O02+ CATGGGGTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
JMFF047C01+ CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
rJMFF039N04- CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
                      ____________________________________________________________
consensus CATGGGCTCACCCAGGGCAGGAGCGGCAGGAGCAGCAGGTGTCTCTGTAACATCTTCACT
 
. : . : . : . : . : . :
rJMSF028L14- CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMSF028L14+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFS076G12+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
rJMFF002L09- CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFS066F07+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
rJMFF035E13- CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTA
JMFN029L17+ CG
JMFN038P05+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAA
rJMSF029F19- CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFF002L09+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMSF029F19+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFF045H01+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFN011A14+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGT-AAGAAGACGACGATGC
JMFF035E13+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
rJMFF026N24- CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
rJMFF006O02- CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFF039N04+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFF046G04+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFF026N24+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFF006O02+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
JMFF047C01+ CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
rJMFF039N04- CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
                      ____________________________________________________________
consensus CGCCATCTTCTCCTGTTGACTAAGCCTTTTGCTCTAAACCTGTGAAGAAGACGACGATGC
 
. : . : . : . : . : . :
rJMSF028L14- GCAGTGAGCAAC
JMSF028L14+ GCAGTGAGCAAC
JMFS076G12+ GCAGTGAGCAA
rJMFF002L09- GCAGTGAGCA
JMFS066F07+ GCAGTGAGCAA
rJMSF029F19- GCAGTGAGCAACGGGAGA
JMFF002L09+ GCAGTGAGCA
JMSF029F19+ GCAGTGAGCAACGGGAGA
JMFF045H01+ GCAGTGAGCAACGGGAGA
JMFN011A14+ GC
JMFF035E13+ GCAGTGAACAAC
rJMFF026N24- GCAGTGAGCAACGGGAGACGAT
rJMFF006O02- GCAGTGAGCAACGGGAGACGATGAAGG
JMFF039N04+ GCAGTGAGCAACGGGAGACGAT
JMFF046G04+ GCAGTGAGCAACGGGAGACGAT
JMFF026N24+ GCAGTGAGCAACGGGAGACGAT
JMFF006O02+ GCAGTGAGCAACGGGAGACGATGAAGG
JMFF047C01+ GCAGTGAGCAACGGGAGACGATG
rJMFF039N04- GCAGTGAGCAACGGGAGACGATC--GGTTCTCGAGTCTTCGCTGTTCCAGACAGCGATGA
                      ____________________________________________________________
consensus GCAGTGAGCAACGGGAGACGATGAAGGTTCTCGAGTCTTCGCTGTTCCAGACAGCGATGA