Previous Contig 010043:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038J23Sequence631010043 (4)gb:AY084519_15696082e-44Arabidopsis thaliana clone 110392 mRNA, complete sequence.760010043 (4)gb:BT003139_16367205e-67Arabidopsis thaliana At5g19680 mRNA, complete cds.
JMFF039M16Sequence630010043 (4)gb:AY084519_15696082e-51Arabidopsis thaliana clone 110392 mRNA, complete sequence.775010043 (4)gb:BT003139_16367206e-69Arabidopsis thaliana At5g19680 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039M16- GCAAAAACGGCCTTCACTCTCCGATGGACCCATCTCCGGGAACCTCCACTCACGGCC
JMFF038J23- GCAAAAACGGCCTTCACTCTCCGATGGACCCATCTCCGGGAACCTCCACTCACGGCC
                      ____________________________________________________________
consensus GCAAAAACGGCCTTCACTCTCCGATGGACCCATCTCCGGGAACCTCCACTCACGGCC
 
. : . : . : . : . : . :
JMFF039M16- ATCCCTCCGATTCAACGCCCGATAACGGCGAAACATCATCGTCTTCGCCAACCGTTCTGG
JMFF038J23- ATCCCTCCGATTCAACGCCCGATAACGGCGAAACATCATCGTCTTCGCCAACCGTTCTGG
                      ____________________________________________________________
consensus ATCCCTCCGATTCAACGCCCGATAACGGCGAAACATCATCGTCTTCGCCAACCGTTCTGG
 
. : . : . : . : . : . :
JMFF039M16- ATCTCACCAGCTTCCAGCTCCATGATCTCGATTCCGTGGACCTCCCCTCGTCTCTCTCCG
JMFF038J23- ATCTCACCAGCTTCCAGCTCCATGATCTCGATTCCGTGGACCTCCCCTCGTCTCTCTCCG
                      ____________________________________________________________
consensus ATCTCACCAGCTTCCAGCTCCATGATCTCGATTCCGTGGACCTCCCCTCGTCTCTCTCCG
 
. : . : . : . : . : . :
JMFF039M16- AGCTCGACTTGACGGCCAACCGTTTGTCGGCGTTAGACCCCCGTATTTCCCACCTCTCCA
JMFF038J23- AGCTCGACTTGACGGCCAACCGTTTGTCGGCGTTAGACCCCCGTATTTCCCACCTCTCCA
                      ____________________________________________________________
consensus AGCTCGACTTGACGGCCAACCGTTTGTCGGCGTTAGACCCCCGTATTTCCCACCTCTCCA
 
. : . : . : . : . : . :
JMFF039M16- ATCTCAACAAATTCTCTCTTCGCCAGAACCTCATTACCGACGCCGCGCTCGAGCCTCTTT
JMFF038J23- ATCTCAACAAATTCTCTCTTCGCCAGAACCTCATTACCGACGCCGCGCTCGAGCCTCTTT
                      ____________________________________________________________
consensus ATCTCAACAAATTCTCTCTTCGCCAGAACCTCATTACCGACGCCGCGCTCGAGCCTCTTT
 
. : . : . : . : . : . :
JMFF039M16- CGTCGTGGCACACCATTTCCCAACTCGAGGAACTAGTGCTCAGGGATAATCAGCTGAAGA
JMFF038J23- CGTCGTGGCACACCATTTCCCAACTCGAGGAACTAGTGCTCAGGGATAATCAGCTGAAGA
                      ____________________________________________________________
consensus CGTCGTGGCACACCATTTCCCAACTCGAGGAACTAGTGCTCAGGGATAATCAGCTGAAGA
 
. : . : . : . : . : . :
JMFF039M16- AAATTCCGGTGTTAGCATATTTAAGAAACTTCTGGTATTTGATGTTTCGTTCAACGAAAT
JMFF038J23- AAATTCCGGTGTTAGCATATTTAAGAAACTTCTGGTATTTGATGTTTCGTTCAACGAAAT
                      ____________________________________________________________
consensus AAATTCCGGTGTTAGCATATTTAAGAAACTTCTGGTATTTGATGTTTCGTTCAACGAAAT
 
. : . : . : . : . : . :
JMFF039M16- TACATCACCTAGCGGATTGTCCAAGGTCTCCAGTACATTGAAGGAGCTCTATGTCTCTAA
JMFF038J23- TACATCACCTAGCGGATTGTCCAAGGTCTCCAGTACATTGAAGGAGCTCTATGTCTCTAA
                      ____________________________________________________________
consensus TACATCACCTAGCGGATTGTCCAAGGTCTCCAGTACATTGAAGGAGCTCTATGTCTCTAA
 
. : . : . : . : . : . :
JMFF039M16- TAATCAAATTGCAAAGATAGAAGAGATCGAACACTTTCACGAGCTGCAGATTCTTGAACT
JMFF038J23- TAATCAAATTGCAAAGATAGAAGAGATCGAACACTTTCACGAGCTGCAGATTCTTGAACT
                      ____________________________________________________________
consensus TAATCAAATTGCAAAGATAGAAGAGATCGAACACTTTCACGAGCTGCAGATTCTTGAACT
 
. : . : . : . : . : . :
JMFF039M16- TGGGTCAAACAAACTACGGGTAATGGAGAATCTGCAAACTTTAACAAATCTACAAGAGCT
JMFF038J23- TGGGTCAAACAAACTACGGGTAATGGAGAATCTGCAAACTTTAACAAATCTACNAGAGCT
rJMFF038J23+ GTAATGGAGAATCTGCAAACTTTAACAAATCTACAAGAGCT
rJMFF039M16+ CAAACAAACTACGGGTAATGGAGAATCTGCAAACTTTAACAAATCTACAAGAGCT
                      ____________________________________________________________
consensus TGGGTCAAACAAACTACGGGTAATGGAGAATCTGCAAACTTTAACAAATCTACAAGAGCT
 
. : . : . : . : . : . :
JMFF039M16- TTGGCTTGGACGCAATCGTATTCGAGCTATCAA
JMFF038J23- TTGGCTTGGACGCAATCGTATTCGAGCTATCAA
rJMFF038J23+ TTGGCTTGGACGCAATCGTATTCGAGCTATCAATTTATGTGGATTGAAATGCATTAAGAA
rJMFF039M16+ TTGGCTTGGACGCAATCGTATTCGAGCTATCAATTTATGTGGATTGAAATGCATTAAGAA
                      ____________________________________________________________
consensus TTGGCTTGGACGCAATCGTATTCGAGCTATCAATTTATGTGGATTGAAATGCATTAAGAA
 
. : . : . : . : . : . :
rJMFF038J23+ GATTAGCATCCAGAGCAACCGTTTGACTTCAATGAAAGGACTGGAGGAATGTGTTGCTCT
rJMFF039M16+ GATTAGCATCCAGAGCAACCGTTTGACTTCAATGAAAGGACTGGAGGAATGTGTTGCTCT
                      ____________________________________________________________
consensus GATTAGCATCCAGAGCAACCGTTTGACTTCAATGAAAGGACTGGAGGAATGTGTTGCTCT
 
. : . : . : . : . : . :
rJMFF038J23+ TGAAGAACTATATCTGAGCCATAATGGTATTGAGAAAATGGAAGGCTTATCAACCCTGGT
rJMFF039M16+ TGAAGAACTATATCTGAGCCATAATGGTATTGAGAAAATGGAAGGCTTATCAACCCTGGT
                      ____________________________________________________________
consensus TGAAGAACTATATCTGAGCCATAATGGTATTGAGAAAATGGAAGGCTTATCAACCCTGGT
 
. : . : . : . : . : . :
rJMFF038J23+ AAACCTTCGAGTCCTGGATGTATCAGCAAACAAGCTTACCGCAATTAGTAACATTGCAAA
rJMFF039M16+ AAACCTTCGAGTCCTGGATGTATCAGCAAACAAGCTTACCGCAATTAGTAACATTGCAAA
                      ____________________________________________________________
consensus AAACCTTCGAGTCCTGGATGTATCAGCAAACAAGCTTACCGCAATTAGTAACATTGCAAA
 
. : . : . : . : . : . :
rJMFF038J23+ CTTGACAAAATTAGAAGATCTTTGGCTTAATGATAACAATATATCATCAGTGGAAGATAT
rJMFF039M16+ CTTGACAAAATTAGAAGATCTTTGGCTTAATGATAACAATATATCATCAGTGGAAGATAT
                      ____________________________________________________________
consensus CTTGACAAAATTAGAAGATCTTTGGCTTAATGATAACAATATATCATCAGTGGAAGATAT
 
. : . : . : . : . : . :
rJMFF038J23+ AGCCGAGGCTGTTGCTGGTTCACTACAGAAACTGACTACCCTATATCTTGAGCGTAACCC
rJMFF039M16+ AGCCGAGGCTGTTGCTGGTTCACTACAGAAACTGACTACCCTATATCTTGAGCGTAACCC
                      ____________________________________________________________
consensus AGCCGAGGCTGTTGCTGGTTCACTACAGAAACTGACTACCCTATATCTTGAGCGTAACCC
 
. : . : . : . : . : . :
rJMFF038J23+ ATGTGCAAATTCTCCAAACTACATCAGTACTTTGAGACAAATTTTCCCCAATATTCAACA
rJMFF039M16+ ATGTGCAAATTCTCCAAACTACATCAGTACTTTGAGACAAATTTTCCCCAATATTCAACA
                      ____________________________________________________________
consensus ATGTGCAAATTCTCCAAACTACATCAGTACTTTGAGACAAATTTTCCCCAATATTCAACA
 
. : . : . : . : . : . :
rJMFF038J23+ AGTGGATTCAGAACTATTTGCATAGTGAGTCATCTTGTCTCAAAAGCCTTTAATTCTGTA
rJMFF039M16+ AGTGGATTCAGAACTATTTGCATAGTGAGTCATCTTGTCTCAAAAGCCTTTAATTCTGTA
                      ____________________________________________________________
consensus AGTGGATTCAGAACTATTTGCATAGTGAGTCATCTTGTCTCAAAAGCCTTTAATTCTGTA
 
. : . : . : . : . : . :
rJMFF038J23+ GCGATTCCAAACCCAAAGAAACATTATCGATTCTCTTTTATTGATACAATCTGCAGCAGA
rJMFF039M16+ GCGATTCCAAACCCAAAGAAACATTATCGATTCTCTTTTATTGATACAATCTGCAGCAGA
                      ____________________________________________________________
consensus GCGATTCCAAACCCAAAGAAACATTATCGATTCTCTTTTATTGATACAATCTGCAGCAGA
 
. : . : . : . : . : . :
rJMFF038J23+ TGAAATGCTCAACTCCCATTAATGGTGTGTGATCCAGCTGCCTCATCGGTTTCAGGTCTC
rJMFF039M16+ TGAAATGCTCAACTCCCATTAATGGTGTGTGATCCAGCTGCCTCATCGGTTTCAGGTCTC
                      ____________________________________________________________
consensus TGAAATGCTCAACTCCCATTAATGGTGTGTGATCCAGCTGCCTCATCGGTTTCAGGTCTC
 
. : . : . : . : . : . :
rJMFF038J23+ TGTGCAAGAGAGTTTTTATTTGGAGCCATTGCTCATAATTTTTCATTTTGCACACTCAAA
rJMFF039M16+ TGTGCAAGAGAGTTTTTATTTGGAGCCATTGCTCATAATTTTTCATTTTGCACACTCAAA
                      ____________________________________________________________
consensus TGTGCAAGAGAGTTTTTATTTGGAGCCATTGCTCATAATTTTTCATTTTGCACACTCAAA
 
. : . : . : . : . : . :
rJMFF038J23+ AACTAACTAGCATTCACATTTCCCTTTGCATAAATTGTCAAGTCACTTATAAAGGAAGT
rJMFF039M16+ AACTAACTAGCATTCACATTTCCCTTTGCATAAATTGTCAAGTCACTTATAAAGGAAGTT
                      ____________________________________________________________
consensus AACTAACTAGCATTCACATTTCCCTTTGCATAAATTGTCAAGTCACTTATAAAGGAAGTT