Previous Contig 010036:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H24Sequence537006151 (10)pir|F86296|F862961e-44hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido693010036 (9)pir|F86296|F862963e-57hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF019D09Sequence542006151 (10)pir|F86296|F862966e-56hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido715010036 (9)pir|F86296|F862967e-60hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF019N22Sequence539006151 (10)pir|F86296|F862962e-62hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido722010036 (9)pir|F86296|F862961e-57hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF020M04Sequence545006151 (10)pir|F86296|F862967e-63hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido691010036 (9)pir|F86296|F862962e-57hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF022B03Sequence501006151 (10)pir|F86296|F862966e-63hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido701010036 (9)pir|F86296|F862966e-61hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMFF039I24Sequence580006151 (10)pir|F86296|F862965e-68hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido741010036 (9)pir|F86296|F862963e-61hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMSF023I12Sequence674006151 (10)pir|F86296|F862962e-68hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido740010036 (9)pir|F86296|F862963e-61hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMSF024M20Sequence636006151 (10)pir|F86296|F862967e-71hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido740010036 (9)pir|F86296|F862965e-73hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido
JMSF044A23Sequence728006151 (10)pir|F86296|F862964e-89hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido738010036 (9)pir|F86296|F862964e-59hypothetical protein T24D18.26 - Arabidopsis thaliana>gb:AE005172_890602 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024M20+ TGCTCCATCTGGACAAGATTGTGGGATAAACACTTT
                      ____________________________________________________________
consensus TGCTCCATCTGGACAAGATTGTGGGATAAACACTTT
 
. : . : . : . : . : . :
rJMSF024M20+ CTTNATAGTCATGACTCTTATTTTTATCTTCGCCTTTGCTATAGTCACACTTCATCC-TT
rJMFF022B03+ TTTGCTATAGTCACACTTCATCN-TT
rJMFF019N22+ GCTATAGTCACACTTCATCCTTT
rJMSF023I12+ ATAGTCACACTTCATCC-TT
rJMSF044A23+ CTATAGTCACACTTCATCC-TT
rJMFF019D09+ ACTTCATCC-TT
rJMFF039I24+ GCTATAGTCACACTTCATCC-TT
                      ____________________________________________________________
consensus CTTNATAGTCATGACTCTTATTTTTATCTTCGCCTTTGCTATAGTCACACTTCATCC-TT
 
. : . : . : . : . : . :
rJMSF024M20+ CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMFF022B03+ CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMFF019N22+ CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMSF023I12+ CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMSF044A23+ CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMFF020M04+ GAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMFF019D09+ CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMFF010H24+ TGAAAGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
rJMFF039I24+ CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
                      ____________________________________________________________
consensus CGGTGAAGGGTAGCATTTTCCCAGCTTCAGTTATATCTCTGTACTGCACATACCTTTGCT
 
. : . : . : . : . : . :
rJMSF024M20+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMFF022B03+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMFF019N22+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMSF023I12+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMSF044A23+ ACAGTGCACTTGCCAGTGAACCTAGGGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMFF020M04+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMFF019D09+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMFF010H24+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
rJMFF039I24+ ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
                      ____________________________________________________________
consensus ACAGTGCACTTGCCAGTGAACCTA-GGGATTATGAATGCAATGCCCTTCATAAGCACTCA
 
. : . : . : . : . : . :
rJMSF024M20+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMFF022B03+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMFF019N22+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMSF023I12+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMSF044A23+ AAATCTGTTTCCACTGGTACANTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMFF020M04+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMFF019D09+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMFF010H24+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
rJMFF039I24+ AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
                      ____________________________________________________________
consensus AAATCTGTTTCCACTGGTACACTAACCCTAGGGCTGCTCACAACTGTATTATCTGTTGTC
 
. : . : . : . : . : . :
rJMSF024M20+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMFF022B03+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMFF019N22+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMSF023I12+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMSF044A23+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMFF020M04+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMFF019D09+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMFF010H24+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
rJMFF039I24+ TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
                      ____________________________________________________________
consensus TACTCTGCTGTCCGTGCTGGATCTTCTACAACTTTGCTTTCCCCTCCTAGCTCACCACGT
 
. : . : . : . : . : . :
rJMSF024M20+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMFF022B03+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMFF019N22+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMSF023I12+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMSF044A23+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMFF020M04+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMFF019D09+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMFF010H24+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
rJMFF039I24+ GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
                      ____________________________________________________________
consensus GCAGGTGGCGGGAAACCTTTGCTACCATTAGACAAGGCGGATGAGCACGAGGAGATGGAG
 
. : . : . : . : . : . :
rJMSF024M20+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMFF022B03+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMFF019N22+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMSF023I12+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMSF044A23+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMFF020M04+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMFF019D09+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMFF010H24+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
rJMFF039I24+ AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
                      ____________________________________________________________
consensus AAATCAAAGGCTGTTACATATTCATATTCATTCTTCCACATTATCTTCTCTCTTGCTAGC
 
. : . : . : . : . : . :
rJMSF024M20+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMFF022B03+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMFF019N22+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMSF023I12+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMSF044A23+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMFF020M04+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMFF019D09+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMFF010H24+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
rJMFF039I24+ ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
                      ____________________________________________________________
consensus ATGTATTCCGCAATGCTGCTCACAGGCTGGTCGACCTCTGTTGGGGAGAGCGGGAAATTG
 
. : . : . : . : . : . :
rJMSF024M20+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMFF022B03+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMFF019N22+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMSF023I12+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMSF044A23+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMFF020M04+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMFF019D09+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMFF010H24+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
rJMFF039I24+ GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
                      ____________________________________________________________
consensus GTGGACGTTGGATGGGCATCGGTTTGGGTTAGAGTTGTGACTGGGTGGGTGACTGCTGCT
 
. : . : . : . : . : . :
rJMSF024M20+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMFF022B03+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMFF019N22+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMSF023I12+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMSF044A23+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMFF020M04+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMFF019D09+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMFF010H24+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
rJMFF039I24+ TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
                      ____________________________________________________________
consensus TTATTTCTCTGGTCTCTGGTTGCTCCAATTCTGTTCCCTGATCGGGACTTCTGAGCATCA
 
. : . : . : . : . : . :
rJMSF024M20+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMFF022B03+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMFF019N22+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMSF023I12+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMSF044A23+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMFF020M04+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMFF019D09+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMFF010H24+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
rJMFF039I24+ TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
                      ____________________________________________________________
consensus TAAGGATGTTGCATAGGAAATCCATATGAAGATAATGACTGAATGTTTATATATTTTCCA
 
. : . : . : . : . : . :
rJMSF024M20+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGAT
rJMFF022B03+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
rJMFF019N22+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
rJMSF023I12+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
rJMSF044A23+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
rJMFF020M04+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
rJMFF019D09+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
rJMFF010H24+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
rJMFF039I24+ TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
                      ____________________________________________________________
consensus TGACATTCCTGTTGTCTGTGTTAAAACATCTCCTTTTCATGACGATTGATCGACATGTTG
 
. : . : . : . : . : . :
rJMFF022B03+ GTCTTGCAAGT
rJMFF019N22+ GTCTTGCAAGTTGGACAAAGTACTTTTGATGTCTTAA
rJMSF023I12+ GTCTTGCAAGTTGGACAAAGTACTTTTGATGTCTTAAATGGAAGTG
rJMSF044A23+ GTCTTGCAAGTTGGACAAAGTACTTTTGATGTCTTAAATGGAAGTG
rJMFF020M04+ GTCTTGCAAGTTGGACAAAGTACTTTTGA
rJMFF019D09+ GTCTTGCAAGTTGGACAAAGTACTTTTGATGTCTTAA
rJMFF010H24+ GTCTTGCAAGTTGGACAAAGTACTTTTGATGTCTTAA
rJMFF039I24+ GTCTTGCAAGTTGGACAAAGTACTTTTGATGTCTTAAATGGAAGTGTAGAAGAAGTGCCA
                      ____________________________________________________________
consensus GTCTTGCAAGTTGGACAAAGTACTTTTGATGTCTTAAATGGAAGTGTAGAAGAAGTGCCA