Previous Contig 010031:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039G05Sequence508010031 (2)gb:AY463620_16077092e-20Arabidopsis thaliana TAF5 (At5g25150) mRNA, complete cds.
JMSF051C08Sequence677010031 (2)gb:AY463620_16077092e-95Arabidopsis thaliana TAF5 (At5g25150) mRNA, complete cds.730013935 (10)gb:AF104396_17682581e-21Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051C08+ ATTACTT
                      ____________________________________________________________
consensus ATTACTT
 
. : . : . : . : . : . :
JMSF051C08+ TGCCAGTGCTTCACATGATCGAACAGCAAGGATCTGGTCAATGGACAGAATACAGCCTCT
                      ____________________________________________________________
consensus TGCCAGTGCTTCACATGATCGAACAGCAAGGATCTGGTCAATGGACAGAATACAGCCTCT
 
. : . : . : . : . : . :
JMSF051C08+ GAGGATAATGGCTGGTCACTTATCTGATGTTGATTGTGTGCAATGGCATGCAAACTGCAA
                      ____________________________________________________________
consensus GAGGATAATGGCTGGTCACTTATCTGATGTTGATTGTGTGCAATGGCATGCAAACTGCAA
 
. : . : . : . : . : . :
JMSF051C08+ CTACATTGCAACTGGATCAAGTGACAAAACTGTTCGGTTGTGGGATGTCCAGAGTGGCGA
                      ____________________________________________________________
consensus CTACATTGCAACTGGATCAAGTGACAAAACTGTTCGGTTGTGGGATGTCCAGAGTGGCGA
 
. : . : . : . : . : . :
JMSF051C08+ GTGTGTCAGAATTTTCATTGGCCATAGGAGTATGATATTGTCGTTGGCGATGTCACCTGA
                      ____________________________________________________________
consensus GTGTGTCAGAATTTTCATTGGCCATAGGAGTATGATATTGTCGTTGGCGATGTCACCTGA
 
. : . : . : . : . : . :
JMSF051C08+ TGGTCGTTATATGGCATCAGGTGATGAAGATGGAAAAATCATGGTGTGGGATCTTGCAAG
                      ____________________________________________________________
consensus TGGTCGTTATATGGCATCAGGTGATGAAGATGGAAAAATCATGGTGTGGGATCTTGCAAG
 
. : . : . : . : . : . :
JMSF051C08+ TGGTCGTTGTATTACCCCTTTGGTTGGTCACGCCTCTTGCGTATGGACACTTGCTTTCAG
                      ____________________________________________________________
consensus TGGTCGTTGTATTACCCCTTTGGTTGGTCACGCCTCTTGCGTATGGACACTTGCTTTCAG
 
. : . : . : . : . : . :
JMSF051C08+ CTGTGAAGGTTCTCTTCTTGCATCTGGTTCTGCTGATTGCACTGTGAAATTATGGGATGT
rJMFF039G05+ CTGATTGCACTGTGAAATTATGGGATGT
                      ____________________________________________________________
consensus CTGTGAAGGTTCTCTTCTTGCATCTGGTTCTGCTGATTGCACTGTGAAATTATGGGATGT
 
. : . : . : . : . : . :
JMSF051C08+ AACCACGAGTACTAAGATGCCAAAATCTGAAGAGAATAAATCTGGAAGTACCAATAGGCT
rJMFF039G05+ AACCACGAGTACTAAGATGCCAAAATCTGAAGAGAATAAATCTGGAAGTACCAATAGGCT
                      ____________________________________________________________
consensus AACCACGAGTACTAAGATGCCAAAATCTGAAGAGAATAAATCTGGAAGTACCAATAGGCT
 
. : . : . : . : . : . :
JMSF051C08+ TCGATCATTGAAGACTCTCCCTACTAAATCCACTCCATTATATGCTTTGCGGTTTTCTCG
rJMFF039G05+ TCGATCATTGAAGACTCTCCCTACTAAATCCACTCCATTATATGCTTTGCGGTTTTCTCG
                      ____________________________________________________________
consensus TCGATCATTGAAGACTCTCCCTACTAAATCCACTCCATTATATGCTTTGCGGTTTTCTCG
 
. : . : . : . : . : . :
JMSF051C08+ AAGAAATCTTCTCTTTGCTGCTGGCGCTTTCTCAAAAAGTGCATAATATTACAACATATT
rJMFF039G05+ AAGAAATCTTCTCTTTGCTGCTGGCGCTTTCTCAAAAAGTGCATAATATTACAACATATT
                      ____________________________________________________________
consensus AAGAAATCTTCTCTTTGCTGCTGGCGCTTTCTCAAAAAGTGCATAATATTACAACATATT
 
. : . : . : . : . : . :
JMSF051C08+ CACATTGGAAAATTTAGACTGATTATGGCTTCTAGATTTCGGGAGCAAGACCAAAAACCG
rJMFF039G05+ CACATTGGAAAATTTAGACTGATTATGGCTTCTAGATTTCGGGAGCAAGACCAAAAACCG
                      ____________________________________________________________
consensus CACATTGGAAAATTTAGACTGATTATGGCTTCTAGATTTCGGGAGCAAGACCAAAAACCG
 
. : . : . : . : . : . :
JMSF051C08+ GGGAGAACTT
rJMFF039G05+ GGGAGAACTTCTCGAGGAGCATTGGGAGAGTTAGAGTAATTGGAAATTCTACTTAGTTTG
                      ____________________________________________________________
consensus GGGAGAACTTCTCGAGGAGCATTGGGAGAGTTAGAGTAATTGGAAATTCTACTTAGTTTG
 
. : . : . : . : . : . :
rJMFF039G05+ CTTTAGTTTTCTTATGCTTCCATATACTTTAGCCACTTATTGGCCTTTATTTTTAGGATT
                      ____________________________________________________________
consensus CTTTAGTTTTCTTATGCTTCCATATACTTTAGCCACTTATTGGCCTTTATTTTTAGGATT
 
. : . : . : . : . : . :
rJMFF039G05+ TTTATACTGGCTTGAGATCTAATTATATTATATATGTTGAAACACAAAGGCCTGTTTATG
                      ____________________________________________________________
consensus TTTATACTGGCTTGAGATCTAATTATATTATATATGTTGAAACACAAAGGCCTGTTTATG
 
. : . : . : . : . : . :
rJMFF039G05+ TCTACGAATATGTAGCCTGATGAGAGGGCACAATGTGTCTATATATATATATATATATAT
                      ____________________________________________________________
consensus TCTACGAATATGTAGCCTGATGAGAGGGCACAATGTGTCTATATATATATATATATATAT