Previous Contig 010029:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039F15Sequence567010029 (4)gb:BC005782_20901643e-05Mus musculus cDNA clone MGC:12025 IMAGE:3603243, complete cds.775010029 (4)gb:BC005782_20901646e-05Mus musculus cDNA clone MGC:12025 IMAGE:3603243, complete cds.
JMFN004C07Sequence371010029 (4)
JMFN034K05Sequence613010029 (4)gb:BC005782_20901644e-05Mus musculus cDNA clone MGC:12025 IMAGE:3603243, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN004C07+ AAAACACTAACAATGATGTCACATTAACCATGAAA
                      ____________________________________________________________
consensus AAAACACTAACAATGATGTCACATTAACCATGAAA
 
. : . : . : . : . : . :
JMFN004C07+ GCTATGGATTCCATCACAGCCACAAAAGCTGAGTTTTCTGTTACCTATAGAGCATTAAAT
rJMFF039F15- TCACAGCCACAAAAGCTGAGTTTTCTGTTACCTATAGAGCATTAAAT
                      ____________________________________________________________
consensus GCTATGGATTCCATCACAGCCACAAAAGCTGAGTTTTCTGTTACCTATAGAGCATTAAAT
 
. : . : . : . : . : . :
JMFN004C07+ ATGTACCATAGTATAATTTATTCATAGGAACTAAATTAAAAGCATTAGCAGTCTTAAAGG
rJMFF039F15- ATGTACCATAGTATAATTTATTCATAGGAACTAAATTAAAAGCATTAGCAGTCTTAAAGG
                      ____________________________________________________________
consensus ATGTACCATAGTATAATTTATTCATAGGAACTAAATTAAAAGCATTAGCAGTCTTAAAGG
 
. : . : . : . : . : . :
JMFN004C07+ TCTTGGCATATGTTTTGCATAGAGGTCAAGAATGGATCACTTCCACTTCTTGAACTTCCC
JMFN034K05+ TGGCATATGTTTTGCATAGAGGTCAAGAATGGATCACTTCCACTTCTTGAACTTCCC
rJMFF039F15- TCTTGGCATATGTTTTGCATAGAGGTCAAGAATGGATCACTTCCACTTCTTGAACTTCCC
                      ____________________________________________________________
consensus TCTTGGCATATGTTTTGCATAGAGGTCAAGAATGGATCACTTCCACTTCTTGAACTTCCC
 
. : . : . : . : . : . :
JMFN004C07+ ACCGCCGAACATCCCTCCATGCTTGCCGCGTTTGAACTTTCCGTGCTTGCCATGCTTGCC
JMFN034K05+ ACCGCCGAACATCCCTCCATGCTTGCCGCGTTTGAACTTTCCGTGCTTGCCATGCTTGCC
JMFF039F15+ CTTGCCGCGTTTGAACTTTCCGTGCTTGCCATGCTTGCC
rJMFF039F15- ACCGCCGAACATCCCTCCATGCTTGCCGCGTTTGAACTTTCCGTGCTTGCCATGCTTGCC
                      ____________________________________________________________
consensus ACCGCCGAACATCCCTCCATGCTTGCCGCGTTTGAACTTTCCGTGCTTGCCATGCTTGCC
 
. : . : . : . : . : . :
JMFN004C07+ ATATTTTCCTTGCTTGAACTTCCCGTGCTTCATCTTTCCATGGCCGTAGTGACCAACACC
JMFN034K05+ ATATTTTCCTTGCTTGAACTTCCCGTGCTTCATCTTTCCATGGCCGTAGTGACCAACACC
JMFF039F15+ ATATTTTCCTTGCTTGAACTTCCCGTGCTTCATCTTTCCATGGCCGTAGTGACCAACACC
rJMFF039F15- ATATTTTCCTTGCTTGAACTTCCCGTGCTTCATCTTTCCATGGCCGTAGTGACCAACACC
                      ____________________________________________________________
consensus ATATTTTCCTTGCTTGAACTTCCCGTGCTTCATCTTTCCATGGCCGTAGTGACCAACACC
 
. : . : . : . : . : . :
JMFN004C07+ ATGTCCAACGCCATGTGGTACAT-AGAACCACTACCG
JMFN034K05+ ATGTCCAACGCCATGTGGTACATGAGAACCACTACCGTGGCTCAAGTGATGAGCACCATA
JMFF039F15+ ATGTCCAACGCCATGTGGTACATGAGAACCACTACCGTGGCTCAAGTGATGAGCACCATA
rJMFF039F15- ATGTCCAACGCCATGTGGTACATGAGAACCACTACCGTGGCTCAAGTGATGAGCACCATA
                      ____________________________________________________________
consensus ATGTCCAACGCCATGTGGTACATGAGAACCACTACCGTGGCTCAAGTGATGAGCACCATA
 
. : . : . : . : . : . :
JMFN034K05+ AGCAGCTGCTGCAGCCACGGCACCTCCAGCTAGCACTGTCCCCATACCAGGTCCATGATG
JMFF039F15+ AGCAGCTGCTGCAGCCACGGCACCTCCAGCTAGCACTGTCCCCATACCAGGTCCATGATG
rJMFF039F15- AGCAGCTGCTGCAGCCACGGCACCTCCAGCTAGCACTGTCCCCATACCAGGTCCATGATG
                      ____________________________________________________________
consensus AGCAGCTGCTGCAGCCACGGCACCTCCAGCTAGCACTGTCCCCATACCAGGTCCATGATG
 
. : . : . : . : . : . :
JMFN034K05+ CCCTGACTTGTGTGGTGCAGATGGGCCAGGGACAGGGTAACCTGAAGGGGGATAGGCTTG
JMFF039F15+ CCCTGACTTGTGTGGTGCAGATGGGCCAGGGACAGGGTAACCTGAAGGGGGATAGGCTTG
rJMFF039F15- CCCTGACTTGTGTGGTGCAGATGGGCCAGGGACAGGGTAACCTGAAGGGGGATAGGCTTG
                      ____________________________________________________________
consensus CCCTGACTTGTGTGGTGCAGATGGGCCAGGGACAGGGTAACCTGAAGGGGGATAGGCTTG
 
. : . : . : . : . : . :
JMFN034K05+ AGGGGGATAGGCTTGAGGGGGATACCCTCCTTGTGGATATCCAGAAGGTGGATATCCAGA
JMFF039F15+ AGGGGGATAGGCTTGAGGGGGATACCCTCCTTGTGGATATCCAGAAGGTGGATATCCAGA
rJMFF039F15- AGGGGGATAGGCTTGAGGGGGATACCCTCCTTGTGGATATCCAGAAGGTGGATATCCAGA
                      ____________________________________________________________
consensus AGGGGGATAGGCTTGAGGGGGATACCCTCCTTGTGGATATCCAGAAGGTGGATATCCAGA
 
. : . : . : . : . : . :
JMFN034K05+ AGGTGGATATGCCTGAGGAGGATATCCTGCAGGTGGATACCCTTGTTGAGGAGGGTATGC
JMFF039F15+ AGGTGGATATGCCTGAGGAGGATATCCTGCAGGTGGATACCCTTGTTGAGGAGGGTATGC
rJMFF039F15- AGGTGGATATGCCTGAGGAGGATATCCTGCAGGTGGATACCCTTGTTGAGGAGGGTATGC
                      ____________________________________________________________
consensus AGGTGGATATGCCTGAGGAGGATATCCTGCAGGTGGATACCCTTGTTGAGGAGGGTATGC
 
. : . : . : . : . : . :
JMFN034K05+ ACCAGGTGCTGGAGGATAATGACCACCATGATGAGCGAGATGAGAAAACAGCCCCTTATC
JMFF039F15+ ACCAGGTGCTGGAGGATAATGACCACCATGATGAGCGAGATGAGAAAACAGCCCCTTATC
rJMFF039F15- ACCAGGTGCTGGAGGATAATGACCACCATGATGAGCGAGATGAGAAAACAGCCCCTTATC
                      ____________________________________________________________
consensus ACCAGGTGCTGGAGGATAATGACCACCATGATGAGCGAGATGAGAAAACAGCCCCTTATC
 
. : . : . : . : . : . :
JMFN034K05+ AGACTCGTCATGCTTATCCTTTCCGCCCCCCATTTCTCTTAGTTAACAAAACAACTTGTA
JMFF039F15+ AGACTCGTCATGCTTATCCTTTCCGCCCCCCATTTCTCTTAGTTAACAAAACAACTTGTA
rJMFF039F15- AGACTCGTCATGCTTATCCTTTCCGCCCCCCATTTCTCTTAGTTAACAAAACAACTTGTA
                      ____________________________________________________________
consensus AGACTCGTCATGCTTATCCTTTCCGCCCCCCATTTCTCTTAGTTAACAAAACAACTTGTA
 
. : . : . : . : . : . :
JMFN034K05+ CAGAGATTCTCTTTGT
JMFF039F15+ CAGAGATTCTCTTTGTGAAGTCGCGATTTGGAATGAAATGAAAGATGT
rJMFF039F15- CAGAGATTCTCTTTGTGAAGTCGCGATTTGGAATGAAATGAAAGATGTCGGTTCTCGACG
                      ____________________________________________________________
consensus CAGAGATTCTCTTTGTGAAGTCGCGATTTGGAATGAAATGAAAGATGTCGGTTCTCGACG