Previous Contig 010027:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039E16Sequence583003873 (3)gb:AY085598_15706660.003Arabidopsis thaliana clone 15906 mRNA, complete sequence.739010027 (3)gb:AY085598_15706663e-50Arabidopsis thaliana clone 15906 mRNA, complete sequence.
JMSF006A19Sequence289006797 (3)311010027 (3)
JMSF020A21Sequence201004722 (6)777010027 (3)gb:AY085598_15706661e-51Arabidopsis thaliana clone 15906 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020A21+ TGAACAAGTGGGCGGAGACCCTAGAG
                      ____________________________________________________________
consensus TGAACAAGTGGGCGGAGACCCTAGAG
 
. : . : . : . : . : . :
rJMSF020A21+ ATGTTCCATACTCAAATCCCATCCATGGAATCACTCCGAGGGAAGGAGAATTGATCAGGA
rJMFF039E16+ GAAGGAGAATTGATCAGGA
                      ____________________________________________________________
consensus ATGTTCCATACTCAAATCCCATCCATGGAATCACTCCGAGGGAAGGAGAATTGATCAGGA
 
. : . : . : . : . : . :
rJMSF020A21+ ACTTCCTGAAGATCAGTGCCAGTCAACTGACTATCTATGGATTGTTTTGCTTGCAAGATG
rJMFF039E16+ ACTTCCTGAAGATCAGTGCCAGTCAACTGACTATCTATGGATTGTTTTGCTTGCAAGATG
                      ____________________________________________________________
consensus ACTTCCTGAAGATCAGTGCCAGTCAACTGACTATCTATGGATTGTTTTGCTTGCAAGATG
 
. : . : . : . : . : . :
rJMSF020A21+ GTCTTAAAGAGCGAGAACTTTGTGTTTTCTTTAGGAACAATCATTTCAACACCATGTTTA
rJMFF039E16+ GTCTTAAAGAGCGAGAACTTTGTGTTTTCTTTAGGAACAATCATTTCAACACCATGTTTA
                      ____________________________________________________________
consensus GTCTTAAAGAGCGAGAACTTTGTGTTTTCTTTAGGAACAATCATTTCAACACCATGTTTA
 
. : . : . : . : . : . :
rJMSF020A21+ AGTTTGAAGGGGATTTATATATTTTGGCTACAGACCAGGGATTTATAAATCAGCCTGAGT
rJMFF039E16+ AGTTTGAAGGGGATTTATATATTTTGGCTACAGACCAGGGATTTATAAATCAGCCTGAGT
                      ____________________________________________________________
consensus AGTTTGAAGGGGATTTATATATTTTGGCTACAGACCAGGGATTTATAAATCAGCCTGAGT
 
. : . : . : . : . : . :
rJMSF020A21+ TGGTGTGGGAAAAGCTCAACGAGGTGAATGGGAACACACAGTACGTGACTGGTAATTTTA
rJMFF039E16+ TGGTGTGGGAAAAGCTCAACGAGGTGAATGGGAACACACAGTACGTGACTGGTAATTTTA
                      ____________________________________________________________
consensus TGGTGTGGGAAAAGCTCAACGAGGTGAATGGGAACACACAGTACGTGACTGGTAATTTTA
 
. : . : . : . : . : . :
rJMSF020A21+ AGGAGTTCAAGGTGGAAACTCTTGCTAGTACACCATGGGATGAGCAGAGTGCCTTAGCCA
rJMFF039E16+ AGGAGTTCAAGGTGGAAACTCTTGCTAGTACACCATGGGATGAGCAGAGTGCCTTAGCCA
                      ____________________________________________________________
consensus AGGAGTTCAAGGTGGAAACTCTTGCTAGTACACCATGGGATGAGCAGAGTGCCTTAGCCA
 
. : . : . : . : . : . :
rJMSF020A21+ ATACAGCTGACTACCTTGCCAGCATTGACAATGCAGCACAAGGGCAATCAAATTTCAATT
rJMFF039E16+ ATACAGCTGACTACCTTGCCAGCATTGACAATGCAGCACAAGGGCAATCAAATTTCAATT
                      ____________________________________________________________
consensus ATACAGCTGACTACCTTGCCAGCATTGACAATGCAGCACAAGGGCAATCAAATTTCAATT
 
. : . : . : . : . : . :
rJMSF020A21+ CCGATCTCCAATTGGCTATAGCTCTTCAGCAGCAGGAATTCGAGCAACAGCAGGCACAAC
rJMSF006A19+ TATAGCTNTTCAGCAGCAGGAATTCGAGCNACANCAGNCACNAC
rJMFF039E16+ CCGATCTCCAATTGGCTATAGCTCTTCAGCAGCAGGAATTCGAGCAACAGCAGGCACAAC
                      ____________________________________________________________
consensus CCGATCTCCAATTGGCTATAGCTCTTCAGCAGCAGGAATTCGAGCAACAGCAGGCACAAC
 
. : . : . : . : . : . :
rJMSF020A21+ AGAACACTCGTAATCAACAACAGCCAACTATAAATGGAGGGTCGGGATTGATAACAGGCC
rJMSF006A19+ AGAACACTCGTAATCNACAACAGCCNACTNTAAATGGAGGGTCGGGANTGNTAACAGGCC
rJMFF039E16+ AGAACACTCGTAATCAACAACAGCCAACTATAAATGGAGGGTCGGGATTGATAACAGGCC
                      ____________________________________________________________
consensus AGAACACTCGTAATCAACAACAGCCAACTATAAATGGAGGGTCGGGATTGATAACAGGCC
 
. : . : . : . : . : . :
rJMSF020A21+ CTCAGGTATCGAGGTACAGTGGACAACAGCAGCAGATGTCTTCGTCTGCGAGGCAGGAGC
rJMSF006A19+ CTCAGGTATCGAGGNACAGTGGNCAACAGCAGCAGATGTCTTCGTCTGCGAGGCAGGAGC
rJMFF039E16+ CTCAGGTATCGAGGTACAGTGGACAACAGCAGCAGATGTCTTCGTCTGCGAGGCAGGAGC
                      ____________________________________________________________
consensus CTCAGGTATCGAGGTACAGTGGACAACAGCAGCAGATGTCTTCGTCTGCGAGGCAGGAGC
 
. : . : . : . : . : . :
rJMSF020A21+ CAAAGTCGGCGAAAGATAAATGCATTGTGATGTAAGATGAGCATGTTATTGTGAAGGTGT
rJMSF006A19+ CAAAGTCGGCGAAAGATAAATGCATTGTGATGTAAGATGAGCATGTTATTGTGAAGGTGT
rJMFF039E16+ CAAAGTCGGCGAAAGATAAATGCATTGTGATGTAAGATGAGCATGTTATTGTGAAGGTGT
                      ____________________________________________________________
consensus CAAAGTCGGCGAAAGATAAATGCATTGTGATGTAAGATGAGCATGTTATTGTGAAGGTGT
 
. : . : . : . : . : . :
rJMSF020A21+ GATGTAAATGATGTGACATTTTGGATTTCCCCTCTTCCTTCCTTTATACCAATAAACCAT
rJMSF006A19+ GATGTAAATGATGTGACATTTTGGATTTCCCCTCTTCCTTCCTCTATACCAATAAACCAT
rJMFF039E16+ GATGTAAATGATGTGACATTTTGGATTTCCCCTCTTCCTTCCTTTATACCAATAAACCAT
                      ____________________________________________________________
consensus GATGTAAATGATGTGACATTTTGGATTTCCCCTCTTCCTTCCTTTATACCAATAAACCAT
 
. : . : . : . : . : . :
rJMSF020A21+ ATTTCCAATTCAAACTCTGCTTTT
rJMSF006A19+ ATTTCCAATTCAAACTCTGCTTTT
rJMFF039E16+ ATTTCCAATTCAAACTCTGCTTTTTATCTCGTGTATATATACAGTCAGTTAATATCATCT
                      ____________________________________________________________
consensus ATTTCCAATTCAAACTCTGCTTTTTATCTCGTGTATATATACAGTCAGTTAATATCATCT