Previous Contig 010024:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018E07Sequence583004620 (6)gb:AY250116_1592725e-101Lycopersicon pennellii aconitase mRNA, partial cds.748010024 (6)gb:AF194945_17758054e-73Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMFF039C14Sequence472004123 (28)gb:AY250115_15927242e-58Lycopersicon pennellii aconitase mRNA, partial cds.699010024 (6)gb:AF194945_17758056e-61Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMFS038D07Sequence659010024 (6)gb:AF194945_1775805e-100Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMSF004I08Sequence311004620 (6)sp|P49608|ACOC_CUCMA6e-51Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).376010024 (6)gb:AF194945_17758052e-06Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMSF028H15Sequence665004620 (6)gb:AY250116_1592725e-118Lycopersicon pennellii aconitase mRNA, partial cds.783010024 (6)gb:AF194945_17758053e-78Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMSF034F05Sequence699004620 (6)gb:AY250116_1592725e-124Lycopersicon pennellii aconitase mRNA, partial cds.736010024 (6)gb:AF194945_17758053e-71Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS038D07- TGGATCGCA
                      ____________________________________________________________
consensus TGGATCGCA
 
. : . : . : . : . : . :
JMFS038D07- AGGACTTCAACTCTTATGGCAGTCGGCGTGGCAATGATGAAATTATGGCAAGGGGAACTT
                      ____________________________________________________________
consensus AGGACTTCAACTCTTATGGCAGTCGGCGTGGCAATGATGAAATTATGGCAAGGGGAACTT
 
. : . : . : . : . : . :
JMFS038D07- TTGCTAATATCCGTCTGGTAAACAAACTGTTAAATGGAGAAGTTGGCCCAAAGACAGTTC
rJMSF028H15+ AAGACAGTTC
                      ____________________________________________________________
consensus TTGCTAATATCCGTCTGGTAAACAAACTGTTAAATGGAGAAGTTGGCCCAAAGACAGTTC
 
. : . : . : . : . : . :
JMFS038D07- ACATCCCAACAGGAGAAAAACTCTATGTGTTTGATGCTGCAATGAGATACAAGTCTGCTG
rJMSF028H15+ ACATCCCAACAGGAGAAAAACTCTATGTGTTTGATGCTGCAATGAGATACAAGTCTGCTG
rJMSF034F05+ CTCTATGTGTTTGATGCTGCAATGAGATACAAGTCTGCTG
rJMFF018E07+ GGAGAAAAACTCTATGTGTTTGATGCTGCAATGAGATACAAGTCTGCTG
                      ____________________________________________________________
consensus ACATCCCAACAGGAGAAAAACTCTATGTGTTTGATGCTGCAATGAGATACAAGTCTGCTG
 
. : . : . : . : . : . :
JMFS038D07- GGCAGGATACCGTAATCTTGGCTGGAGCAGAGTATGGAAGTGGAAGCTCCAGAGATTGGG
rJMSF028H15+ GGCAGGATACCGTAATCTTGGCTGGAGCAGAGTATGGAAGTGGAAGCTCCAGAGATTGGG
rJMSF034F05+ GGCAGGATACCGTAATCTTGGCTGGAGCAGAGTATGGAAGTGGAAGCTCCAGAGATTGGG
rJMFF018E07+ GGCAGGATACCGTAATCTTGGCTGGAGCAGAGTATGGAAGTGGAAGCTCCAGAGATTGGG
rJMFF039C14+ CTGGAGCAGAGTATGGAAGTGGAAGCTCCAGAGATTGGG
                      ____________________________________________________________
consensus GGCAGGATACCGTAATCTTGGCTGGAGCAGAGTATGGAAGTGGAAGCTCCAGAGATTGGG
 
. : . : . : . : . : . :
JMFS038D07- CTGCCAAGGGACCAATGTTGTTGGGAGTAAAAGCAGTAATTGCTAAAAGCTTTGAGAGGA
rJMSF028H15+ CTGCCAAGGGACCAATGTTGTTGGGAGTAAAAGCAGTAATTGCTAAAAGCTTTGAGAGGA
rJMSF034F05+ CTGCCAAGGGACCAATGTTGTTGGGAGTAAAAGCAGTAATTGCTAAAAGCTTTGAGAGGA
rJMFF018E07+ CTGCCAAGGGACCAATGTTGTTGGGAGTAAAAGCAGTAATTGCTAAAAGCTTTGAGAGGA
rJMFF039C14+ CTGCCAAGGGACCAATGTTGTTGGGAGTAAAAGCAGTAATTGCTAAAAGCTTTGAGAGGA
                      ____________________________________________________________
consensus CTGCCAAGGGACCAATGTTGTTGGGAGTAAAAGCAGTAATTGCTAAAAGCTTTGAGAGGA
 
. : . : . : . : . : . :
JMFS038D07- TACACCGCAGTAACCTGGTTGGAATGGGCATTATTCCTTTATGTTTCAAGGCTGGAGAAG
rJMSF028H15+ TACACCGCAGTAACCTGGTTGGAATGGGCATTATTCCTTTATGTTTCAAGGCTGGAGAAG
rJMSF034F05+ TACACCGCAGTAACCTGGTTGGAATGGGCATTATTCCTTTATGTTTCAAGGCTGGAGAAG
rJMFF018E07+ TACACCGCAGTAACCTGGTTGGAATGGGCATTATTCCTTTATGTTTCAAGGCTGGAGAAG
rJMFF039C14+ TACACCGCAGTAACCTGGTTGGAATGGGCATTATTCCTTTATGTTTCAAGGCTGGAGAAG
                      ____________________________________________________________
consensus TACACCGCAGTAACCTGGTTGGAATGGGCATTATTCCTTTATGTTTCAAGGCTGGAGAAG
 
. : . : . : . : . : . :
JMFS038D07- ATGCAGACACACTTGGATTAACAGGCCATGAGCGTTACACCATTGATCTCCCCAGCAAAA
rJMSF028H15+ ATGCAGACACACTTGGATTAACAGGCCATGAGCGTTACACCATTGATCTCCCCAGCAAAA
rJMSF034F05+ ATGCAGACACACTTGGATTAACAGGCCATGAGCGTTACACCATTGATCTCCCCAGCAAAA
rJMFF018E07+ ATGCAGACACACTTGGATTAACAGGCCATGAGCGTTACACCATTGATCTCCCCAGCAAAA
rJMFF039C14+ ATGCAGACACACTTGGATTAACAGGCCATGAGCGTTACACCATTGATCTCCCCAGCAAAA
                      ____________________________________________________________
consensus ATGCAGACACACTTGGATTAACAGGCCATGAGCGTTACACCATTGATCTCCCCAGCAAAA
 
. : . : . : . : . : . :
JMFS038D07- TTAGTGATATTCGCCCTGGACAGGATGTTACTGTTCAAACTGACACAGGAAAATGTTTCA
rJMSF028H15+ TTAGTGATATTCGCCCTGGACAGGATGTTACTGTTCAAACTGACACAGGAAAATGTTTCA
rJMSF034F05+ TTAGTGATATTCGCCCTGGACAGGATGTTACTGTTCAAACTGACACAGGAAAATGTTTCA
rJMFF018E07+ TTAGTGATATTCGCCCTGGACAGGATGTTACTGTTCAAACTGACACAGGAAAATGTTTCA
rJMFF039C14+ TTAGTGATATTCGCCCTGGACAGGATGTTACTGTTCAAACTGACACAGGAAAATGTTTCA
                      ____________________________________________________________
consensus TTAGTGATATTCGCCCTGGACAGGATGTTACTGTTCAAACTGACACAGGAAAATGTTTCA
 
. : . : . : . : . : . :
JMFS038D07- CATGCACTGCTCGGTTTGATACTGAGGTGGAGTTGGCCTATTTCAACCATGGAGGCATTC
rJMSF028H15+ CATGCACTGCTCGGTTTGATACTGAGGTGGAGTTGGCCTATTTCAACCATGGAGGCATTC
rJMSF034F05+ CATGCACTGCTCGGTTTGATACTGAGGTGGAGTTGGCCTATTTCAACCATGGAGGCATTC
rJMSF004I08+ GATACTGAGGTGGAGTTGGCCTATTTCAACCATGGAGGCATTC
rJMFF018E07+ CATGCACTGCTCGGTTTGATACTGAGGTGGAGTTGGCCTATTTCAACCATGGAGGCATTC
rJMFF039C14+ CATGCACTGCTCGGTTTGATACTGAGGTGGAGTTGGCCTATTTCAACCATGGAGGCATTC
                      ____________________________________________________________
consensus CATGCACTGCTCGGTTTGATACTGAGGTGGAGTTGGCCTATTTCAACCATGGAGGCATTC
 
. : . : . : . : . : . :
JMFS038D07- TTCCATATGTTATTCGCCAATTGACCCAGCAATGAGCAACTGCATTTATTGGTACAATTG
rJMSF028H15+ TTCCATATGTTATTCGCCAATTGACCCAGCAATGAGCAACTGCATTTATTGGTACAATTG
rJMSF034F05+ TTCCATATGTTATTCGCCAATTGACCCAGCAATGAGCAACTGCATTTATTGGTACAATTG
rJMSF004I08+ TTCCATATGTTATTCGCCAATTGACCCAGCAATGAGCAACTGCATTTATTGGTACAATNG
rJMFF018E07+ TTCCATATGTTATTCGCCAATTGACCCAGCAATGAGCAACTGCATTTATTGGTACAATTG
rJMFF039C14+ TTCCATATGTTATTCGCCAATTGACCCAGCAATGAGCAACTGCATTTATTGGTACAATTG
                      ____________________________________________________________
consensus TTCCATATGTTATTCGCCAATTGACCCAGCAATGAGCAACTGCATTTATTGGTACAATTG
 
. : . : . : . : . : . :
JMFS038D07- TCAGGCTGGTGGATATTGCAGTTGTAGTGGTGTGCCAGTTTAATTGGGAA
rJMSF028H15+ TCAGGCTGGTGGATATTGCAGTTGTAGTGGTGTGCCAGTTTAATTGGGAACGGAATAAAT
rJMSF034F05+ TCAGGCTGGTGGATATTGCAGTTGTAGTGGTGTGCCAGTTTAATTGGGAACGGAATAAAT
rJMSF004I08+ TCAGGCTGGTGGATATTGCAGTTGTAGTGGTGTGCCAGTTTAATTGGGAACGGAATAAAT
rJMFF018E07+ TCAGGCTGGTGGATATTGCAGTTGTAGTGGTGTGCCAGTTTAATTGGGAACGGAATAAAT
rJMFF039C14+ TCAGGCTGGTGGATATTGCAGTTGTAGTGGTGTGCCAGTTTAATTGGGAACGGAATAAAT
                      ____________________________________________________________
consensus TCAGGCTGGTGGATATTGCAGTTGTAGTGGTGTGCCAGTTTAATTGGGAACGGAATAAAT
 
. : . : . : . : . : . :
rJMSF028H15+ GGCCATGCAATTGTATTTACACTCTTATTAGAGAGGGTATCTTCCAGTAACATCGGCAGA
rJMSF034F05+ GGCCATGCAATTGTATTTACACTCTTATTAGAGAGGGTATCTTCCAGTAACATCGGCAGA
rJMSF004I08+ GGCCATGCAATTGTATTTACACTCTTATTAGAGAGGGTATCTTCCAGTAACATCGGCAGA
rJMFF018E07+ GGCCATGCAATTGTATTTACACTCTTATTAGAGAGGGTATCTTCCAGTAACATCGGCAGA
rJMFF039C14+ GGCCATGCAATTGTATTTACACTCTTATTAGAGAGGGTATCTTCCAGTAACATCGGCAGA
                      ____________________________________________________________
consensus GGCCATGCAATTGTATTTACACTCTTATTAGAGAGGGTATCTTCCAGTAACATCGGCAGA
 
. : . : . : . : . : . :
rJMSF028H15+ GTTAAATTGTTGGCAATGAGTAGAGGATGTCATTTTTTCTAATAATCTTGTATTCATATT
rJMSF034F05+ GTTAAATTGTTGGCAATGAGTAGAGGATGTCATTTTTTCTAATAATCTTGTATTCATATT
rJMSF004I08+ GTTAAATTGTTGGCAATGAGTAGAGGATGTCATTTTTTCTAATAATCTTGTATTCATATT
rJMFF018E07+ GTTAAATTGTTGGCAATGAGTAGAGGATGTCATTTTTTCTAATAATCTTGTATTCATATT
rJMFF039C14+ GTTAAATTGTTGGCAATGAGTAGAGGATGTCATTTTTTCTAATAATCTTGTATTCATATT
                      ____________________________________________________________
consensus GTTAAATTGTTGGCAATGAGTAGAGGATGTCATTTTTTCTAATAATCTTGTATTCATATT
 
. : . : . : . : . : . :
rJMSF028H15+ TCCTTCAGACATGATTCTCTACTGTCTTTAACGCAGCGAAGCTTAACTAGTCTTCAGGGG
rJMSF034F05+ TCCTTCAGACATGATTCTCTACTGTCTTTAACGCAGCGAAGCTTAACTAGTCTTCAGGGG
rJMSF004I08+ TCCTTCAGACATGATTCTCTACTGTCTTTAACGCAGCGAAGCTTAACTAGTCTTCAGGGG
rJMFF018E07+ TCCTTCAGACATGATTCTCTACTGTCTTTAACGCAGCGAAGCTTAACTAGTCTTCAGGGG
rJMFF039C14+ TCCTTCAGACATGATTCTCTACTGTCTTTAACGCAGCGAAGCTTAACTAGTCTTCAGGGG
                      ____________________________________________________________
consensus TCCTTCAGACATGATTCTCTACTGTCTTTAACGCAGCGAAGCTTAACTAGTCTTCAGGGG
 
. : . : . : . : . : . :
rJMSF028H15+ ATATACATTGATGACATTTTGATATCTCAAACTATG
rJMSF034F05+ ATATACATTGATGACATTTTGATATCTCAAACTATG
rJMSF004I08+ ATATACATTGATGACATTTTGATATCTCAAACT
rJMFF018E07+ ATATACATTGATGACATTTTGATATCTCAAACTATG
rJMFF039C14+ ATATACATTGATGACATTTTGATATCTCAAACTATGCTAGAAACATGAAGTTTATATATT
                      ____________________________________________________________
consensus ATATACATTGATGACATTTTGATATCTCAAACTATGCTAGAAACATGAAGTTTATATATT