Previous Contig 010017:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038O06Sequence525007110 (3)pir|H86453|H864531e-12avr9 homolog F9L11.10 [imported] - Arabidopsis thaliana>gb:AE005172_892124 Arabi500010017 (4)pir|H86453|H864537e-55avr9 homolog F9L11.10 [imported] - Arabidopsis thaliana>gb:AE005172_892124 Arabi
JMFF039O08Sequence769010017 (4)pir|H86453|H86453e-114avr9 homolog F9L11.10 [imported] - Arabidopsis thaliana>gb:AE005172_892124 Arabi
JMSF036M04Sequence605007110 (3)pir|H86453|H864539e-15avr9 homolog F9L11.10 [imported] - Arabidopsis thaliana>gb:AE005172_892124 Arabi708010017 (4)pir|H86453|H86453e-110avr9 homolog F9L11.10 [imported] - Arabidopsis thaliana>gb:AE005172_892124 Arabi
JMSF037M04Sequence680019957sp|Q889X8|RPOB_PSESMe-121DNA-directed RNA polymerase beta chain (EC 2.7.7.6) (RNAP beta subunit) (Transcr532010017 (4)pir|H86453|H864535e-73avr9 homolog F9L11.10 [imported] - Arabidopsis thaliana>gb:AE005172_892124 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039O08+ TGACGCTGAAGAAACCACAACATAAAGATTTCTT
                      ____________________________________________________________
consensus TGACGCTGAAGAAACCACAACATAAAGATTTCTT
 
. : . : . : . : . : . :
rJMSF036M04+ ACTGAACCATATAGAGGGATATCATGAATTGTCGACAAAAACCCAAATCTACTTTTC
rJMFF039O08+ AAGACTGAACCATATAGAGGGATATCATGAATTGTCGACAAAAACCCAAATCTACTTTTC
                      ____________________________________________________________
consensus AAGACTGAACCATATAGAGGGATATCATGAATTGTCGACAAAAACCCAAATCTACTTTTC
 
. : . : . : . : . : . :
rJMSF036M04+ AACTGCTGCAGCAAAGTGGGATGCCGACTTCTATGTCAAAGTCGATGACGATGTGCATGT
rJMFF039O08+ AACTGCTGCAGCAAAGTGGGATGCCGACTTCTATGTCAAAGTCGATGACGATGTGCATGT
                      ____________________________________________________________
consensus AACTGCTGCAGCAAAGTGGGATGCCGACTTCTATGTCAAAGTCGATGACGATGTGCATGT
 
. : . : . : . : . : . :
rJMSF036M04+ CAATCTTGGTATAGTAGGTTCAATCTTAGCCCGTCATCGGTCTAAACCTCGTGTTTATGT
rJMFF039O08+ CAATCTTGGTATAGTAGGTTCAATCTTAGCCCGTCATCGGTCTAAACCTCGTGTTTATGT
                      ____________________________________________________________
consensus CAATCTTGGTATAGTAGGTTCAATCTTAGCCCGTCATCGGTCTAAACCTCGTGTTTATGT
 
. : . : . : . : . : . :
rJMSF037M04+ CGGCTGCATGAAGTCTGGGGCCCGTTCTCGCACAGAAAGGTNTGAAGTATCATGAACCAG
rJMSF036M04+ CGGCTGCATGAAGTCT-GGGCCCGTTCTCGCACAGAAAGGTGTGAAGTATCATGAACCAG
rJMFF039O08+ CGGCTGCATGAAGTCT-GGGCCCGTTCTCGCACAGAAAGGTGTGAAGTATCATGAACCAG
                      ____________________________________________________________
consensus CGGCTGCATGAAGTCT-GGGCCCGTTCTCGCACAGAAAGGTGTGAAGTATCATGAACCAG
 
. : . : . : . : . : . :
rJMSF037M04+ AATACTGGAAATTTGGGGAGGAGGGTAATAAGTACTTTAGGCATGCAACTGGACAAATAT
rJMSF036M04+ AATACTGGAAATTTGGGGAGGAGGGTAATAAGTACTTTAGGCATGCAACTGGACAAATAT
rJMFF039O08+ AATACTGGAAATTTGGGGAGGAGGGTAATAAGTACTTTAGGCATGCAACTGGACAAATAT
rJMFF038O06+ GGCATGCAACTGGACAAATAT
                      ____________________________________________________________
consensus AATACTGGAAATTTGGGGAGGAGGGTAATAAGTACTTTAGGCATGCAACTGGACAAATAT
 
. : . : . : . : . : . :
rJMSF037M04+ ATGCAATCTCCAAGGATTTGGCTACCTATATATCGATTAACAGGAACATACTTCATCGAT
rJMSF036M04+ ATGCAATCTCCAAGGATTTGGCTACCTATATATCGATTAACAGGAACATACTTCATCGAT
rJMFF039O08+ ATGCAATCTCCAAGGATTTGGCTACCTATATATCGATTAACAGGAACATACTTCATCGAT
rJMFF038O06+ ATGCAATCTCCAAGGATTTGGCTACCTATATATCGATTAACAGGAACATACTTCATCGAT
                      ____________________________________________________________
consensus ATGCAATCTCCAAGGATTTGGCTACCTATATATCGATTAACAGGAACATACTTCATCGAT
 
. : . : . : . : . : . :
rJMSF037M04+ ATGCAAATGAAGACGTTTCTCTTGGATCTTGGTTTATTGGGCTTGATGTAGAGCATATAG
rJMSF036M04+ ATGCAAATGAAGACGTTTCTCTTGGATCTTGGTTTATTGGGCTTGATGTAGAGCATATAG
rJMFF039O08+ ATGCAAATGAAGACGTTTCTCTTGGATCTTGGTTTATTGGGCTTGATGTAGAGCATATAG
rJMFF038O06+ ATGCAAATGAAGACGTTTCTCTTGGATCTTGGTTTATTGGGCTTGATGTAGAGCATATAG
                      ____________________________________________________________
consensus ATGCAAATGAAGACGTTTCTCTTGGATCTTGGTTTATTGGGCTTGATGTAGAGCATATAG
 
. : . : . : . : . : . :
rJMSF037M04+ ATGACCGAAGCTTGTGCTGTGGGACACCGCCTGATTGTGAGTGGAAGTCCCAGGCGGGGA
rJMSF036M04+ ATGACCGAAGCTTGTGCTGTGGGACACCGCCTGATTGTGAGTGGAAGTCCCAGGCGGGGA
rJMFF039O08+ ATGACCGAAGCTTGTGCTGTGGGACACCGCCTGATTGTGAGTGGAAGTCCCAGGCGGGGA
rJMFF038O06+ ATGACCGAAGCTTGTGCTGTGGGACACCGCCTGATTGTGAGTGGAAGTCCCAGGCGGGGA
                      ____________________________________________________________
consensus ATGACCGAAGCTTGTGCTGTGGGACACCGCCTGATTGTGAGTGGAAGTCCCAGGCGGGGA
 
. : . : . : . : . : . :
rJMSF037M04+ ACCTTTGTGCTGCGTCATTTGATTGGAGCTGTAGCGGGGTATGTAAATCGGTAGAAAGAA
rJMSF036M04+ ACCTTTGTGCTGCGTCATTTGATTGGAGCTGTAGCGGGGTATGTAAATCGGTAGAAAGAA
rJMFF039O08+ ACCTTTGTGCTGCGTCATTTGATTGGAGCTGTAGCGGGGTATGTAAATCGGTAGAAAGAA
rJMFF038O06+ ACCTTTGTGCTGCGTCATTTGATTGGAGCTGTAGCGGGGTATGTAAATCGGTAGAAAGAA
                      ____________________________________________________________
consensus ACCTTTGTGCTGCGTCATTTGATTGGAGCTGTAGCGGGGTATGTAAATCGGTAGAAAGAA
 
. : . : . : . : . : . :
rJMSF037M04+ TGGAAGAGGTGCACCAGAGATGCGGAGAGGGCGATGGAGCAATCTGGCATACCAGCTTTT
rJMSF036M04+ TGGAAGAGGTGCACCAGAGATGCGGAGAGGGCGATGGAGCAATCTGGCATACCAGCTTTT
rJMFF039O08+ TGGAAGAGGTGCACCAGAGATGCGGAGAGGGCGATGGAGCAATCTGGCATACCAGCTTTT
rJMFF038O06+ TGGAAGAGGTGCACCAGAGATGCGGAGAGGGCGATGGAGCAATCTGGCATACCAGCTTTT
                      ____________________________________________________________
consensus TGGAAGAGGTGCACCAGAGATGCGGAGAGGGCGATGGAGCAATCTGGCATACCAGCTTTT
 
. : . : . : . : . : . :
rJMSF037M04+ AGAACTTGTGTACTTAACGAATCTCTTCTTATTTATTCATTAGATTGTCTTTGCGGTTTT
rJMSF036M04+ AGAACTTGTGTACTTAACGAATCTCTTCTTATTTATTCATTAGATTGTCTTTGCGGTTTT
rJMFF039O08+ AGAACTTGTGTACTTAACGAATCTCTTCTTATTTATTCATTAGATTGTCTTTGCGGTTTT
rJMFF038O06+ AGAACTTGTGTACTTAACGAATCTCTTCTTATTTATTCATTAGATTGTCTTTGCGGTTTT
                      ____________________________________________________________
consensus AGAACTTGTGTACTTAACGAATCTCTTCTTATTTATTCATTAGATTGTCTTTGCGGTTTT
 
. : . : . : . : . : . :
rJMSF037M04+ TGTTCTTGCCCTCCCTCGGGAAGGGATCTTGATCGGTGGAATGTATATGTCC
rJMSF036M04+ TGTTCTTGCCCTCCCTCGGGAAGGGATCTTGANCGGTGGAATGTATATGTCC
rJMFF039O08+ TGTTCTTGCCCTCCCTCGGGAAGGGATCTTGA-CGGTGGAATGTATATGTCCGTGTGCAG
rJMFF038O06+ TGTTCTTGCCCTCCCTCGGGGAGGGATCTTGA-CGGTGGAATGTATATGTCCGTGTGCAG
                      ____________________________________________________________
consensus TGTTCTTGCCCTCCCTCGGGAAGGGATCTTGATCGGTGGAATGTATATGTCCGTGTGCAG
 
. : . : . : . : . : . :
rJMFF039O08+ TAATCAGAAATGCGACC
rJMFF038O06+ TAATCAGAAATGCGACCTGTGTACATCGTTCCACGCCATTTTTGCTCAGAAAGACTCACA
                      ____________________________________________________________
consensus TAATCAGAAATGCGACCTGTGTACATCGTTCCACGCCATTTTTGCTCAGAAAGACTCACA