Previous Contig 010011:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023P01Sequence470010011 (3)gb:OSJN00025_16935041e-26Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02, complete seque740010011 (3)gb:OSJN00025_16935041e-32Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02, complete seque
JMFF038L14Sequence474001667 (3)715010011 (3)gb:OSJN00025_16935042e-23Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023P01- GAAATTCCCAACTGTATAGTGATAGCAAGGATGGATCAAATGGTGAAGCACC
                      ____________________________________________________________
consensus GAAATTCCCAACTGTATAGTGATAGCAAGGATGGATCAAATGGTGAAGCACC
 
. : . : . : . : . : . :
JMFF023P01- CAAGAAAATTGATTCTAGGAGCTCAATTGTGAAATTTGGTTTGCCCACATCTGGAAAAGT
                      ____________________________________________________________
consensus CAAGAAAATTGATTCTAGGAGCTCAATTGTGAAATTTGGTTTGCCCACATCTGGAAAAGT
 
. : . : . : . : . : . :
JMFF023P01- TCTGAATAAGAAGAGAAATTATGCCCAATTGCATTTGGAATTTGGTCAGTCTGATTTTTT
                      ____________________________________________________________
consensus TCTGAATAAGAAGAGAAATTATGCCCAATTGCATTTGGAATTTGGTCAGTCTGATTTTTT
 
. : . : . : . : . : . :
JMFF023P01- CTTGCACACTTGCAATGTATGCAACTTCCAGTATGCTACTGGTCAAGAAGGGGATGAGAA
                      ____________________________________________________________
consensus CTTGCACACTTGCAATGTATGCAACTTCCAGTATGCTACTGGTCAAGAAGGGGATGAGAA
 
. : . : . : . : . : . :
JMFF023P01- GGTTCACCAGGCATTTCACAAGAATTACACTGTTGGAATCCCATTTAAGTGCTGGAAGAA
                      ____________________________________________________________
consensus GGTTCACCAGGCATTTCACAAGAATTACACTGTTGGAATCCCATTTAAGTGCTGGAAGAA
 
. : . : . : . : . : . :
JMFF023P01- TGAAAGAATTATTCCAATTCCTTCATTTGAAGCAGGACGCATTATCTTGGTCTTAAATGA
                      ____________________________________________________________
consensus TGAAAGAATTATTCCAATTCCTTCATTTGAAGCAGGACGCATTATCTTGGTCTTAAATGA
 
. : . : . : . : . : . :
JMFF023P01- TGACCCTCCTCCTTGGAGAAACAAGGTTCAGGAAGTCGTAAAGATGATGGAGGTGGAACT
rJMFF023P01+ CAAGGTTCAGGAAGTCGTAAAGATGATGGAGGTGGAACT
                      ____________________________________________________________
consensus TGACCCTCCTCCTTGGAGAAACAAGGTTCAGGAAGTCGTAAAGATGATGGAGGTGGAACT
 
. : . : . : . : . : . :
JMFF023P01- TGGTGAAGGGTGGATATATAATCAGCAATGCAAGGTGTATTTGTTTATCTCTTCTCGA
rJMFF023P01+ TGGTGAAGGGTGGATATATAATCAGCAATGCAAGGTGTATTTGTTTATCTCTTCTCGAAG
                      ____________________________________________________________
consensus TGGTGAAGGGTGGATATATAATCAGCAATGCAAGGTGTATTTGTTTATCTCTTCTCGAAG
 
. : . : . : . : . : . :
rJMFF023P01+ AATTGGTGGATGCCTGGTAGCAGAACCTATAAAGGAGGCGTATAGAATTGTCTCTAGTTC
rJMFF038L14+ GTGGATGCCTGGTAGCAGANCCTATAAAGGAGGCGTATAGGATNGTCTCTAGTTC
                      ____________________________________________________________
consensus AATTGGTGGATGCCTGGTAGCAGAACCTATAAAGGAGGCGTATAGGATTGTCTCTAGTTC
 
. : . : . : . : . : . :
rJMFF023P01+ GCAAGGCAACAAGTCTAGTGTTGCGGCTGAAAGGGAAGTAAGTCAGAGATCTACGGTTCT
rJMFF038L14+ GCAAGGCAACAAGTCTAGTGTTGCGGCTGAAAGGGAAGTAAGTCAGAGATCTACGGTTCT
                      ____________________________________________________________
consensus GCAAGGCAACAAGTCTAGTGTTGCGGCTGAAAGGGAAGTAAGTCAGAGATCTACGGTTCT
 
. : . : . : . : . : . :
rJMFF023P01+ GCAGTTTGGAGGAGTCAGTTTTCAACGGGAAAAAGTAAGAAGAGATCCCCCAAAAGAAAG
rJMFF038L14+ GCAGTTTGGAGGAGTCAGTTTTCAACGGGAAAAAGTAAGAAGAGATCCCCCAAAAGAAAG
                      ____________________________________________________________
consensus GCAGTTTGGAGGAGTCAGTTTTCAACGGGAAAAAGTAAGAAGAGATCCCCCAAAAGAAAG
 
. : . : . : . : . : . :
rJMFF023P01+ ACTCGATGGTTTAGATGATGGCCTAAATGGAGTGATCTTGTGTGAGAAGGAAGCTGTACC
rJMFF038L14+ ACTCGATGGTTTAGATGATGGCCTAAATGGAGTGATCTTGTGTGAGAAGGAAGCTGTACC
                      ____________________________________________________________
consensus ACTCGATGGTTTAGATGATGGCCTAAATGGAGTGATCTTGTGTGAGAAGGAAGCTGTACC
 
. : . : . : . : . : . :
rJMFF023P01+ TGCTTTGTGTGGCATTAGAGCCATTTGGGTCACTCCTTCCAATAGAAGAAAACACATTGC
rJMFF038L14+ TGCTTTGTGTGGCATTAGAGCCATTTGGGTCACTCCTTCCAATAGAAGAAAACACATTGC
                      ____________________________________________________________
consensus TGCTTTGTGTGGCATTAGAGCCATTTGGGTCACTCCTTCCAATAGAAGAAAACACATTGC
 
. : . : . : . : . : . :
rJMFF023P01+ TAGTTATTTGCTTGATGCTGCAAGGAAAAGTTTTTGCAATGGTCAAGTTCTCTTGCGTTC
rJMFF038L14+ TAGTTATTTGCTTGATGCTGCAAGGAAAAGTTTTTGCAATGGTCAAGTTCTCTTGCGTTC
                      ____________________________________________________________
consensus TAGTTATTTGCTTGATGCTGCAAGGAAAAGTTTTTGCAATGGTCAAGTTCTCTTGCGTTC
 
. : . : . : . : . : . :
rJMFF023P01+ GGAGCTCGCATTTTCTCAGCCAACTTCAGTTGGAAAGGTATTCATATCCAGCTATACTAG
rJMFF038L14+ GGAGCTCGCATTTTCTCAGCCAACTTCAGTTGGAAAGGTATTCATATCCAGCTATACTAG
                      ____________________________________________________________
consensus GGAGCTCGCATTTTCTCAGCCAACTTCAGTTGGAAAGGTATTCATATCCAGCTATACTAG
 
. : . : . : . : . : . :
rJMFF023P01+ CAGTTCATCCTTCTTCATATACACCTCCAGTGGCTCTAAGTAGTCTCCATCTTCTTTCAG
rJMFF038L14+ CAGTTCATCCTTCTTCATATACACCTCCAGTGGCTCTAAGTAGTCTCCATCTTCTTTCAG
                      ____________________________________________________________
consensus CAGTTCATCCTTCTTCATATACACCTCCAGTGGCTCTAAGTAGTCTCCATCTTCTTTCAG
 
. : . : . : . : . : . :
rJMFF023P01+ CAACTTCTTTAGGTACTGCTTAATCCATCTTTCATGTGGTTCTTATATTTGAATTGGATA
rJMFF038L14+ CAACTTCTTTAGGTACTGCTTAATCCATCTTTCATGTGGTTCTTATATTTGAATTGGATA
                      ____________________________________________________________
consensus CAACTTCTTTAGGTACTGCTTAATCCATCTTTCATGTGGTTCTTATATTTGAATTGGATA
 
. : . : . : . : . : . :
rJMFF023P01+ AATTATACTTTGATGAGTAGCCAGCTGTAGGCTTCACTTCACAGGACACGATATTTGTCT
rJMFF038L14+ AATTATACTTTGATGAGTAGCCAGCTGTAGGCTTCACTTCACAGGACACGATATTTGTCT
                      ____________________________________________________________
consensus AATTATACTTTGATGAGTAGCCAGCTGTAGGCTTCACTTCACAGGACACGATATTTGTCT
 
. : . : . : . : . : . :
rJMFF023P01+ TGTTTGACAATTAACGATTAGTGAATAACGGATTATA
rJMFF038L14+ TGTTTGACAATTAACGATTAGTGAATAACGGATTATATTAATAGTTTTGACTAGTGAATT
                      ____________________________________________________________
consensus TGTTTGACAATTAACGATTAGTGAATAACGGATTATATTAATAGTTTTGACTAGTGAATT
 
. : . : . : . : . : . :
rJMFF038L14+ CTCTTAGTAATTTAATTGTAAGAAGATCTTATACTGTTCCTCCATAACATATAACACAAC
                      ____________________________________________________________
consensus CTCTTAGTAATTTAATTGTAAGAAGATCTTATACTGTTCCTCCATAACATATAACACAAC