Previous Contig 010009:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038L05Sequence410005246 (2)gb:BT015757_16423756e-11Arabidopsis thaliana At3g60510 mRNA, complete cds.>gb:BT020182_1642577 Arabidops202010009 (2)
JMSF011H15Sequence452005246 (2)gb:BT015757_16423758e-32Arabidopsis thaliana At3g60510 mRNA, complete cds.>gb:BT020182_1642577 Arabidops185010009 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011H15+ CCCCC
rJMFF038L05+ TTTGGGNAAAANANNGNTCCCCC
                      ____________________________________________________________
consensus TTTGGGNAAAANANNGNTCCCCC
 
. : . : . : . : . : . :
rJMSF011H15+ CCCCCCCCCCCCTACCCTCTCGACCCTCGAGTAGAAATGCTGTTATTCTTTTTCCCGCTT
rJMFF038L05+ CCCCCCCCCCCCTACCCTCTCGACCCTCGAGTAGAAATGCTGTTATTCTTTTTCCCGCTT
                      ____________________________________________________________
consensus CCCCCCCCCCCCTACCCTCTCGACCCTCGAGTAGAAATGCTGTTATTCTTTTTCCCGCTT
 
. : . : . : . : . : . :
rJMSF011H15+ AGCTAGGAATGAACGAGGAAAAGTGAGAAAGCATCCCCGATTGTACTCCAGATTGATCAT
rJMFF038L05+ AGCTAGGAATGAACGAGGAAAAGTGAGAAAGCATCCCCGATTGTACTCCAGATTGATCAT
                      ____________________________________________________________
consensus AGCTAGGAATGAACGAGGAAAAGTGAGAAAGCATCCCCGATTGTACTCCAGATTGATCAT
 
. : . : . : . : . : . :
rJMSF011H15+ TCTATTGCTGTCTCGGAATAATATCTTTACCATGTTGCCTGT
rJMFF038L05+ TCTATTGCTGTCTCGGAATAATATCTTTA-CATGTTGCCTGTTGGTGGTACCAGCTTCCA
                      ____________________________________________________________
consensus TCTATTGCTGTCTCGGAATAATATCTTTACCATGTTGCCTGTTGGTGGTACCAGCTTCCA