Previous Contig 009998:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024M03Sequence569009998 (8)gb:AY087677_15727056e-48Arabidopsis thaliana clone 37589 mRNA, complete sequence.723009998 (8)gb:AY087677_15727057e-66Arabidopsis thaliana clone 37589 mRNA, complete sequence.
JMFF038I08Sequence511009998 (8)gb:AY087677_15727054e-33Arabidopsis thaliana clone 37589 mRNA, complete sequence.732009998 (8)gb:AP002486_18222641e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMSF014L05Sequence586009998 (8)gb:AY087677_15727058e-20Arabidopsis thaliana clone 37589 mRNA, complete sequence.724009998 (8)gb:AP002486_18222642e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMSF037I04Sequence682009998 (8)gb:AY087677_15727055e-69Arabidopsis thaliana clone 37589 mRNA, complete sequence.612009998 (8)gb:AP002486_18222641e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014L05- GGTTGGTCCTCCCTCTGCCTCGCCACGACGCCACCGCC
                      ____________________________________________________________
consensus GGTTGGTCCTCCCTCTGCCTCGCCACGACGCCACCGCC
 
. : . : . : . : . : . :
JMSF014L05- CACCACTGCCACCAGCTTCCCGGTCCCCGTCTTCACCCTCAGTCCGCCTCAGTCGCCGGT
                      ____________________________________________________________
consensus CACCACTGCCACCAGCTTCCCGGTCCCCGTCTTCACCCTCAGTCCGCCTCAGTCGCCGGT
 
. : . : . : . : . : . :
JMSF014L05- CGTGAGCCGCCTCCGTCTTCACCAGTCACCACCGTCCAGTCGCCGCCTCGCCTCAGTTAT
                      ____________________________________________________________
consensus CGTGAGCCGCCTCCGTCTTCACCAGTCACCACCGTCCAGTCGCCGCCTCGCCTCAGTTAT
 
. : . : . : . : . : . :
JMSF014L05- GGAGAGAGCGTAGATGAATATTATCCCGTAGTTCATCAGAAACCTTGTATGGTGGAGAGA
                      ____________________________________________________________
consensus GGAGAGAGCGTAGATGAATATTATCCCGTAGTTCATCAGAAACCTTGTATGGTGGAGAGA
 
. : . : . : . : . : . :
JMSF014L05- TTAGAGACGACAGGAAAGGACGAGAAGAGAAGAGAGAGATACAGCCGGAAATGGCGGATT
JMFF038I08- AGAGAGAGATTCAGTCGGAAATGGCGGATT
JMFF024M03- AGAGAGAGATTCAGTCGGAAATGGCGGATT
JMSF037I04- AGAGAGAGATTCAGTCGGAAATGGCGGATT
                      ____________________________________________________________
consensus TTAGAGACGACAGGAAAGGACGAGAAGAGAAGAGAGAGATTCAGTCGGAAATGGCGGATT
 
. : . : . : . : . : . :
JMSF014L05- ACCACTTCGTGTACAAGGACGTGGAAGGAGCTTCTACTCAGTGGGATGACATTCAGAGGA
JMFF038I08- ACCACTTTGTGTACAAGGACGTGGAAGGAGCTTCTACTCAGTGGGATGACATTCAGAGGA
JMFF024M03- ACCACTTTGTGTACAAGGACGTGGAAGGAGCTTCTACTCAGTGGGATGACATTCAGAGGA
JMSF037I04- ACCACTTTGTGTACAAGGACGTGGAAGGAGCTTCTACTCAGTGGGATGACATTCAGAGGA
                      ____________________________________________________________
consensus ACCACTTTGTGTACAAGGACGTGGAAGGAGCTTCTACTCAGTGGGATGACATTCAGAGGA
 
. : . : . : . : . : . :
JMSF014L05- AACTCGGAAACCTCCCTCCCAAGTCGCCTCCTTTCAAGCCACCGCCTTTCACCCCCGCCG
JMFF038I08- AACTTGGAAACCTCCCTCCCAAGCCGCCTCCTTTCAAGCCACCGCCTTTCACCCCCGCTG
JMFF024M03- AACTTGGAAACCTCCCTCCCAAGCCGCCTCCTTTCAAGCCACCGCCTTTCACCCCCGCTG
JMSF037I04- AACTTGGAAACCTCCCTCCCAAGCCGCCTCCTTTCAAGCCACCGCCTTTCACCCCCGCTG
rJMSF014L05+ G
rJMFF024M03+ CCGCTG
                      ____________________________________________________________
consensus AACTTGGAAACCTCCCTCCCAAGCCGCCTCCTTTCAAGCCACCGCCTTTCACCCCCGCTG
 
. : . : . : . : . : . :
JMSF014L05- AAGATGAAGACTCCTCCCAGCCCAAGGACAAGGCATGGATCGATAAGAAATCCGCCGAAG
JMFF038I08- AAGATGAAGACTCCTCTAAGCCCAAGGACAAGGCATGGATCGATAAGAAATCCGCCGAAG
JMFF024M03- AAGATGAAGACTCCTCTAAGCCCAAGGACAAGGCATGGATCGATAAGAAATCCGCCGAAG
JMSF037I04- AAGATGAAGACTCCTCTAAGCCCAAGGACAAGGCATGGATCGATAAGAAATCCGCCGAAG
rJMSF014L05+ AAGATGAAGACTCCTCCCAGCCCAAGGACAAGGCATGGATCGATAAGAAATCCGCCGAAG
rJMFF024M03+ AAGATGAAGACTCCTCTAAGCCCAAGGACAAGGCATGGATCGATAAGAAATCCGCCGAAG
                      ____________________________________________________________
consensus AAGATGAAGACTCCTCTAAGCCCAAGGACAAGGCATGGATCGATAAGAAATCCGCCGAAG
 
. : . : . : . : . : . :
JMSF014L05- AGCTCGAAGAAATTGAAGATGATTTTGACGAAGACCCCTTCCTTGAAGAGTACAGGAAGA
JMFF038I08- AGCTCGAAGATATTGAAGATGATCTTGACGAAGACCCCTTCCTTGAAGAGTACAGGAAGA
JMFF024M03- AGCTCGAAGATATTGAAGATGATCTTGACGAAGACCCCTTCCTTGAAGAGTACAGGAAGA
JMSF037I04- AGCTCGAAGATATTGAAGATGATCTTGACGAAGACCCCTTCCTTGAAGAGTACAGGAAGA
rJMSF014L05+ AGCTCGAAGAAATTGAAGATGATTTTGACGAAGACCCCTTCCTTGAAGAGTACAGGAAGA
rJMFF024M03+ AGCTCGAAGATATTGAAGATGATCTTGACGAAGACCCCTTCCTTGAAGAGTACAGGAAGA
rJMFF038I08+ GAAGAGTACAGGAAGA
                      ____________________________________________________________
consensus AGCTCGAAGATATTGAAGATGATCTTGACGAAGACCCCTTCCTTGAAGAGTACAGGAAGA
 
. : . : . : . : . : . :
JMSF014L05- AGAGGTTGGCAGATATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGCGTGATT-CCA
JMFF038I08- AGAGGTTGGCAGAGATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGGGTGATTCCCA
JMFF024M03- AGAGGTTGGCAGAGATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGGGTGATTCCCA
JMSF037I04- AGAGGTTGGCAGAGATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGGGTGATTCCCA
rJMSF014L05+ AGAGGTTGGCAGATATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGCGTGATTCCCA
rJMFF024M03+ AGAGGTTGGCAGAGATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGGGTGATTCCCA
rJMSF037I04+ GATGGGTGATTNCCA
rJMFF038I08+ AGAGGTTGGCAGAGATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGGGTGATTCCCA
                      ____________________________________________________________
consensus AGAGGTTGGCAGAGATGCAAGCAGCAGCCAAGGTTGCAAAGTTTGGATGGGTGATTCCCA
 
. : . : . : . : . : . :
JMSF014L05- TTTCTGGAT
JMFF038I08- TTTCTGGATCAGATTTTGTACGTGAGGTATCACAAGCTCCGCCAGATGTTTTGGGTGGTT
JMFF024M03- TTTCTGGATCAGATTTTGTACGTGAGGTATCACAAGCTCCGCCAGATGTTTTGGGTGGTT
JMSF037I04- TTTCTGGATCAGATTTTGTACGTGAGGTATCACAAGCTCCGCCAGATG-TTTGGGTGGTT
rJMSF014L05+ TTTCTGGATCAGATTTTGTACGTGAGGTATCACAAGCTCCGCCAGATG-TTTGGGTGATT
rJMFF024M03+ TTTCTGGATCAGATTTTGTACGTGAGGTATCACAAGCTCCGCCAGATG-TTTGGGTGGTT
rJMSF037I04+ TTTCTGGANCAGATTTNGTNCGTGAGGTATCACNAGCTCCGCCAGATG-TTTGGGNGGTT
rJMFF038I08+ TTTCTGGATCAGATTTTGTACGTGAGGTATCACAAGCTCCGCCAGATG-TTTGGGTGGTT
                      ____________________________________________________________
consensus TTTCTGGATCAGATTTTGTACGTGAGGTATCACAAGCTCCGCCAGATG-TTTGGGTGGTT
 
. : . : . : . : . : . :
JMFF038I08- GTTCTTTTATACAAGGATGGATATGCAGATTGCAGGGTGCTGTTGCAGTGCTTAGAAGAA
JMFF024M03- GTTCTTTTATACAAGGATGGATATGCAGATTGCAGGGTGCTGTTGCAGTGCTTAGAAGAA
JMSF037I04- GTTCTTTTATACAAGGATGGATATGCAGATTGCAGGGTGCTGTTGCAGTGCTTAGAAGAA
rJMSF014L05+ GTTCTTTTATACAAGGATGGATATGCAGATTGCCGGGTGCTGTTGCAGTGCTTAGAAGAA
rJMFF024M03+ GTTCTTTTATACAAGGATGGATATGCAGATTGCAGGGTGCTGTTGCAGTGCTTAGAAGAA
rJMSF037I04+ GTTCTTTTATACAAGGATGGANATGCAGATTGCAGGGTGCTGNTGCAGTGCTTAGNAGAA
rJMFF038I08+ GTTCTTTTATACAAGGATGGATATGCAGATTGCAGGGTGCTGTTGCAGTGCTTAGAAGAA
                      ____________________________________________________________
consensus GTTCTTTTATACAAGGATGGATATGCAGATTGCAGGGTGCTGTTGCAGTGCTTAGAAGAA
 
. : . : . : . : . : . :
JMFF038I08- TTGGCTACTAAAT
JMFF024M03- TTGGCTACTAAATATCCAGCAACAAAGTTTGTCAAGATTATATCTACTGATTGTATCCAT
JMSF037I04- TTGGCTACTAAATATCCAGCAACAAAGTTTGTCAAGATTATATCTACTGATTGTATCCAT
rJMSF014L05+ TTGGCTACTAAATACCCAGCAACAAAGTTTGTCAAGATTATATCTACCGATTGTATCCAT
rJMFF024M03+ TTGGCTACTAAATATCCAGCAACAAAGTTTGTCAAGATTATATCTACTGATTGTATCCAT
rJMSF037I04+ TTGGNTANTAAATATCCAGCAACAAAGTTNGTCAAGATTATATCTNCTGATTGTATCCAT
rJMFF038I08+ TTGGCTACTAAATATCCAGCAACAAAGTTTGTCAAGATTATATCTACTGATTGTATCCAT
                      ____________________________________________________________
consensus TTGGCTACTAAATATCCAGCAACAAAGTTTGTCAAGATTATATCTACTGATTGTATCCAT
 
. : . : . : . : . : . :
JMFF024M03- AACTATCCAGATCGCAATCTTCCTACTCTATTG
JMSF037I04- AACTATCCAGATCGCAATCTTCCTACTCTATTGGTTTACAACAACAGCGCTGTCAAGGCA
rJMSF014L05+ AACTACCCAGATCGCAATCTTCCTACTCTATTGGTTTACAACAACAGCGCTGTCAAGGCA
rJMFF024M03+ AACTATCCAGATCGCAATCTTCCTACTCTATTGGTTTACAACAACAGCGCTGTCAAGGCA
rJMSF037I04+ AACTATCCAGATCGCAATCNTCCTNCTTTATNGGTTTACAACAACAGCGCTGTCAAGGCA
rJMFF038I08+ AACTATCCAGATCGCAATCTTCCTACTCTATTGGTTTACAACAACAGCGCTGTCAAGGCA
                      ____________________________________________________________
consensus AACTATCCAGATCGCAATCTTCCTACTCTATTGGTTTACAACAACAGCGCTGTCAAGGCA
 
. : . : . : . : . : . :
JMSF037I04- AATTTTGTTGGGATTCATAGTTTTGGTCGGAGATGCACACCTGAAAGTGTTGCCCTGCTT
rJMSF014L05+ AATTATATTGGGATGCATAGTTTTGGTCGGAGATGCACTCCCGAAAGTGTTGCCCTCGTT
rJMFF024M03+ AATTTTGTTGGGATTCATAGTTTTGGTCGGAGATGCACACCTGAAAGTGTTGCCCTGCTT
rJMSF037I04+ AATNTTGNNGGGATTCATAGTTTTGGTNGGAGATGCNCACCNGAAAGNGNTGCCCNGCTT
rJMFF038I08+ AATTTTGTTGGGATTCATAGTTTTGGTCGGAGATGCACACCTGAAAGTGTTGCCCTGCTT
                      ____________________________________________________________
consensus AATTTTGTTGGGATTCATAGTTTTGGTCGGAGATGCACACCTGAAAGTGTTGCCCTGCTT
 
. : . : . : . : . : . :
JMSF037I04- CTCTGCCAATCTGATCCAGTACT
rJMSF014L05+ CTCTGCCAATCTGATCCGGTACTCAACGATGGCCATGGTGGAGAAAAGCAGTCGAGAGAA
rJMFF024M03+ CTCTGCCAATCTGATCCAGTACTCAATGATGGCCATGGT---GAAAAGCAGTCGAGAGAA
rJMSF037I04+ CTCNGCCAATCTGATCCAGTACTCAANGATGGCCATGGT---GAAAAGCAGTCGAGAGNA
rJMFF038I08+ CTCTGCCAATCTGATCCAGTACTCAATGATGGCCATGGT---GAAAAGCAGTCGAGAGAA
                      ____________________________________________________________
consensus CTCTGCCAATCTGATCCAGTACTCAATGATGGCCATGGT---GAAAAGCAGTCGAGAGAA
 
. : . : . : . : . : . :
rJMSF014L05+ GCTGTTCTTGATGGAGTTCGGAAGAGGTTTCTTGAGAAGGTTGTTGCAGAGCATGAAAAT
rJMFF024M03+ GCTGTTCTTGATGGAGTTCGGAAGAGGTTTCTTGAGAAGGTTGTTGCAGACCATGAAAAT
rJMSF037I04+ GCTGTTCTTGATGGAGTTCGGAAGAGGTTTCTTGAGAAGGTTGTTGCAGNCCATGAAAAT
rJMFF038I08+ GCTGTTCTTGATGGAGTTCGGAAGAGGTTTCTTGAGAAGGTTGTTGCAGACCATGAAAAT
                      ____________________________________________________________
consensus GCTGTTCTTGATGGAGTTCGGAAGAGGTTTCTTGAGAAGGTTGTTGCAGACCATGAAAAT
 
. : . : . : . : . : . :
rJMSF014L05+ G
rJMFF024M03+ GATGATGGTTCTGACAGTGAGTGATT
rJMSF037I04+ GNNGATGGTTCTGACAGNGNGTGANTAGNTAGNTGANTTGGTTTTCCCCNTTCTTNNNGT
rJMFF038I08+ GATGATGGTTCTGACAGTGAGTGATTAGCTAGCTGATTTGGTTTTCCCCTTTCTTTTAGT
                      ____________________________________________________________
consensus GATGATGGTTCTGACAGTGAGTGATTAGCTAGCTGATTTGGTTTTCCCCTTTCTTTTAGT
 
. : . : . : . : . : . :
rJMSF037I04+ GTGATGANTTTGGAGGGTGCCTTTCAACTNTCAACTCAACATAAAAGCGNCTCTATATAT
rJMFF038I08+ GTGATGATTTTGGAGGGTGCCTTTCAACTTTCAACTCAACATAAAAGCGTCTCTATATAT
                      ____________________________________________________________
consensus GTGATGATTTTGGAGGGTGCCTTTCAACTTTCAACTCAACATAAAAGCGTCTCTATATAT
 
. : . : . : . : . : . :
rJMSF037I04+ NGTGGGAATATAGACACGACAAAGCTTCTNGCTTGGTTTTCGCANTGTATCAACTCCGAA
rJMFF038I08+ TGTGGGAATATAGACACGACAAAGCTTCTTGCTTGGTTTTCGCATTGTATCAACTCCGAA
                      ____________________________________________________________
consensus TGTGGGAATATAGACACGACAAAGCTTCTTGCTTGGTTTTCGCATTGTATCAACTCCGAA
 
. : . : . : . : . : . :
rJMSF037I04+ C
rJMFF038I08+ CTAACATGTTTTCTTTCATTCCTGAATGGAAGGCAAGGCACTTATATCAAACCTAAGCCT
                      ____________________________________________________________
consensus CTAACATGTTTTCTTTCATTCCTGAATGGAAGGCAAGGCACTTATATCAAACCTAAGCCT