Previous Contig 009994:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038H10Sequence551009994 (2)779009994 (2)gb:AB010069_15108497e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAC9.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038H10- GATTCAAGCCGCTGTTCCTCA
                      ____________________________________________________________
consensus GATTCAAGCCGCTGTTCCTCA
 
. : . : . : . : . : . :
JMFF038H10- AATCGCCCTGCAAGCTGCGGGGGATTTGAGACATAATTCAACGGAACAAAACCAAATTCG
                      ____________________________________________________________
consensus AATCGCCCTGCAAGCTGCGGGGGATTTGAGACATAATTCAACGGAACAAAACCAAATTCG
 
. : . : . : . : . : . :
JMFF038H10- ATCCCCAAAACCAAGCATATGAAGGAAGAAGATAACGTGTTTTCAACCGCGGACGCAATG
rJMFF038H10+ TCCCCAAANCCAAGCATATGAAGGAAGAAGATAACGTGTTTTCAACCGCGGACGCAATG
                      ____________________________________________________________
consensus ATCCCCAAAACCAAGCATATGAAGGAAGAAGATAACGTGTTTTCAACCGCGGACGCAATG
 
. : . : . : . : . : . :
JMFF038H10- GTGGAATACAAAACTCATTCCGCCCCTCCCACGCCCCTTCACGACAAGGGGTTGACGAAG
rJMFF038H10+ GTGGAATACAAAACTCATTCCGCCCCTCCCACGCCCCTTCACGACAAGGGGTTGACGAAG
                      ____________________________________________________________
consensus GTGGAATACAAAACTCATTCCGCCCCTCCCACGCCCCTTCACGACAAGGGGTTGACGAAG
 
. : . : . : . : . : . :
JMFF038H10- AAGAAACGCACTAGGTCGTTCAGTCTCCTCAAAGCTGCGCTCAACATTTTCCACGATAAA
rJMFF038H10+ AAGAAACGCACTAGGTCGTTCAGTCTCCTCAAAGCTGCGCTCAACATTTTCCACGATAAA
                      ____________________________________________________________
consensus AAGAAACGCACTAGGTCGTTCAGTCTCCTCAAAGCTGCGCTCAACATTTTCCACGATAAA
 
. : . : . : . : . : . :
JMFF038H10- CCCAGCGAGAAGGAGGAGAATAAGAAACCGAAGAAGAAGAGCAACGATTGGAAGAGGGTG
rJMFF038H10+ CCCAGCGAGAAGGAGGAGAATAAGAAACCGAAGAAGAAGAGCAACGATTGGAAGAGGGTG
                      ____________________________________________________________
consensus CCCAGCGAGAAGGAGGAGAATAAGAAACCGAAGAAGAAGAGCAACGATTGGAAGAGGGTG
 
. : . : . : . : . : . :
JMFF038H10- GTGGAGTCAATGCGGCCATTAACACTGCAAGACAAATCTCCCTCTCCCTCGCCCTCGGTT
rJMFF038H10+ GTGGAGTCAATGCGGCCATTAACACTGCAAGACAAATCTCCCTCTCCCTCGCCCTCGGTT
                      ____________________________________________________________
consensus GTGGAGTCAATGCGGCCATTAACACTGCAAGACAAATCTCCCTCTCCCTCGCCCTCGGTT
 
. : . : . : . : . : . :
JMFF038H10- CCGAGGTCGCCGTCGTCTTCCTTCGAGAATCTAACGTTGTATGGGACGGTCCCTGTCTCT
rJMFF038H10+ CCGAGGTCGCCGTCGTCTTCCTTCGAGAATCTAACGTTGTATGGGACGGTCCCTGTCTCT
                      ____________________________________________________________
consensus CCGAGGTCGCCGTCGTCTTCCTTCGAGAATCTAACGTTGTATGGGACGGTCCCTGTCTCT
 
. : . : . : . : . : . :
JMFF038H10- CCCTCGGTTTCCTCCGTCTCCTCCCGCAGCGGCATGAGCCANTACGCCTCCGCACCCAAT
rJMFF038H10+ CCCTCGGTTTCCTCCGTCTCCTCCCGCAGCGGCATGAGCCAGTACGCCTCCGCACCCAAT
                      ____________________________________________________________
consensus CCCTCGGTTTCCTCCGTCTCCTCCCGCAGCGGCATGAGCCAGTACGCCTCCGCACCCAAT
 
. : . : . : . : . : . :
JMFF038H10- CTCCAGGCACTGGACACCGGATCTGATGATCCCGACGAGGTTTTTGACGC
rJMFF038H10+ CTCCAGGCACTGGACACCGGATCTGATGATCCCGACGAGGTTTTTGACGCCATCGGAGGC
                      ____________________________________________________________
consensus CTCCAGGCACTGGACACCGGATCTGATGATCCCGACGAGGTTTTTGACGCCATCGGAGGC
 
. : . : . : . : . : . :
rJMFF038H10+ GATGAGATGATCGACGTCAAAGCTGAAGAATTCATTACTCAATTCTACAAACAAATGAAG
                      ____________________________________________________________
consensus GATGAGATGATCGACGTCAAAGCTGAAGAATTCATTACTCAATTCTACAAACAAATGAAG
 
. : . : . : . : . : . :
rJMFF038H10+ CTTCAAGCAATTCAAGAATTTTGAATCATTAGCCACAGCCCAAAACATGCATCATAATCG
                      ____________________________________________________________
consensus CTTCAAGCAATTCAAGAATTTTGAATCATTAGCCACAGCCCAAAACATGCATCATAATCG
 
. : . : . : . : . : . :
rJMFF038H10+ GTTTTTGATACTCTCCATCTGTTTAGTTTAACCAGGAGGAGGTACTATACGTCAATTTTC
                      ____________________________________________________________
consensus GTTTTTGATACTCTCCATCTGTTTAGTTTAACCAGGAGGAGGTACTATACGTCAATTTTC
 
. : . : . : . : . : . :
rJMFF038H10+ TCCACAATGGAGTTGTTTCCTTGTAGTAGTTTGTTCTTCCCAAACTGTACTCATCATGTA
                      ____________________________________________________________
consensus TCCACAATGGAGTTGTTTCCTTGTAGTAGTTTGTTCTTCCCAAACTGTACTCATCATGTA
 
. : . : . : . : . : . :
rJMFF038H10+ TGATTTGATTTGTAACTGGTTGTTTGAATTGCCACAATATAATGAAACAAACGAACAANA
                      ____________________________________________________________
consensus TGATTTGATTTGTAACTGGTTGTTTGAATTGCCACAATATAATGAAACAAACGAACAANA