Previous Contig 009982:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002N05Sequence556000109 (4)gb:BT011692_16412142e-40Arabidopsis thaliana At3g14067 gene, complete cds.>gb:BT012275_1641481 Arabidops711009982 (2)gb:AP004846_18458848e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMFF038B24Sequence457000109 (4)gb:BT011692_16412141e-47Arabidopsis thaliana At3g14067 gene, complete cds.>gb:BT012275_1641481 Arabidops743009982 (2)gb:AP004846_18458842e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038B24+ GGAGCCCAATCCACTCAGTTTCA
                      ____________________________________________________________
consensus GGAGCCCAATCCACTCAGTTTCA
 
. : . : . : . : . : . :
rJMFF002N05+ ATGGATCTGGCCACGTTGATCCAAACAGGGCCCTGGATCCGGGTTTGGTCTACGATTT
rJMFF038B24+ TTATGGATCTGGCCACGTTGATCCAAACAGGGCCCTGGGTCCGGGTTTGGTCTACGATTT
                      ____________________________________________________________
consensus TTATGGATCTGGCCACGTTGATCCAAACAGGGCCCTGGGTCCGGGTTTGGTCTACGATTT
 
. : . : . : . : . : . :
rJMFF002N05+ AGGAGTTAGTGATTACGTGGATTTCCTATGCACCATTGGATATGACTCTCAGACAATTTG
rJMFF038B24+ AGGAGTTAGTGATTACGTGGATTTCCTATGCACCATTGGATATGACTCTCAGACAATTTG
                      ____________________________________________________________
consensus AGGAGTTAGTGATTACGTGGATTTCCTATGCACCATTGGATATGACTCTCAGACAATTTG
 
. : . : . : . : . : . :
rJMFF002N05+ GGTGGTCACGGGGGATTACGTGGATTGCAGGACACGAAGTTTGGGGAACCCCGGCTCTCT
rJMFF038B24+ GGTGGTCACGGGGGATTACGTGGATTGCAGGACACGAAGTTTGGGGAACCCCGGCTCTCT
                      ____________________________________________________________
consensus GGTGGTCACGGGGGATTACGTGGATTGCAGGACACGAAGTTTGGGGAACCCCGGCTCTCT
 
. : . : . : . : . : . :
rJMFF002N05+ AAATTACCCTTCCTTTTCAGTTACTTTCGACAGATTCAACACCGTAACCTACAAGAGAAC
rJMFF038B24+ AAATTACCCTTCCTTTTCAGTTACTTTCGACAGATTCAACACCGTAACCTACAAGAGAAC
                      ____________________________________________________________
consensus AAATTACCCTTCCTTTTCAGTTACTTTCGACAGATTCAACACCGTAACCTACAAGAGAAC
 
. : . : . : . : . : . :
rJMFF002N05+ AGTAAAAAATGTGGGGACCAATAAAAACGCGGTTTATGAGGTAAAAGTGAATATGTTTTC
rJMFF038B24+ AGTAAAAAATGTGGGGACCAATAAAAACGCGGTTTATGAGGTAAAAGTGAATATGTTTTC
                      ____________________________________________________________
consensus AGTAAAAAATGTGGGGACCAATAAAAACGCGGTTTATGAGGTAAAAGTGAATATGTTTTC
 
. : . : . : . : . : . :
rJMFF002N05+ GGGTGTTGCAGTGAGCGTGTCACCGACCAGACTGGTGTTCAATGAGAATAATGATACGCT
rJMFF038B24+ GGGTGTTGCAGTGAGCGTGTCACCGACCAGACTGGTGTTCAATGAGAATAATGATACGCT
                      ____________________________________________________________
consensus GGGTGTTGCAGTGAGCGTGTCACCGACCAGACTGGTGTTCAATGAGAATAATGATACGCT
 
. : . : . : . : . : . :
rJMFF002N05+ ATCTTATGAGGTAACTTTTACATTGCTGGTACAACCTGGCTTTGCGGCATATGGGTCGAT
rJMFF038B24+ ATCTTATGAGGTAACTTTTACATTGCTGGTACAACCTGGCTTTGCGGCATATGGGTCGAT
                      ____________________________________________________________
consensus ATCTTATGAGGTAACTTTTACATTGCTGGTACAACCTGGCTTTGCGGCATATGGGTCGAT
 
. : . : . : . : . : . :
rJMFF002N05+ AGTCTGGGAGGACGGGGTGCATGTTGTTAGTAGCCCAATAACGGTTAATGTGCAACCTCG
rJMFF038B24+ AGTCTGGGAGGACGGGGTGCATGTTGTTAGTAGCCCAATAACGGTTAATGTGCAACCTCG
                      ____________________________________________________________
consensus AGTCTGGGAGGACGGGGTGCATGTTGTTAGTAGCCCAATAACGGTTAATGTGCAACCTCG
 
. : . : . : . : . : . :
rJMFF002N05+ TTTGCTATCTAGCTAAATGCTAATTAAATGTCTGCATAATTTGCTTTTATGTACCTTGTG
rJMFF038B24+ TTTGCTATCTAGCTAAATGCTAATTAAATGTCTGCATAATTTGCTTTTATGTACCTTGTG
                      ____________________________________________________________
consensus TTTGCTATCTAGCTAAATGCTAATTAAATGTCTGCATAATTTGCTTTTATGTACCTTGTG
 
. : . : . : . : . : . :
rJMFF002N05+ TAATGGAATAAATCCACATAATATATATTATTATGGTGGATAAATCTACGTAAGTGTGGT
rJMFF038B24+ TAATGGAATAAATCCACATAATATATATTATTATGGTGGATAAATCTACGTAAGTGTGGT
                      ____________________________________________________________
consensus TAATGGAATAAATCCACATAATATATATTATTATGGTGGATAAATCTACGTAAGTGTGGT
 
. : . : . : . : . : . :
rJMFF002N05+ GTAGAAATGTACCTTGTTCGTTCTTATGTATCCTATGTAATAAAAAATAATAAT
rJMFF038B24+ GTAGAAATGTACCTTGTTCGTTCTTATGTATCCTATGTAATAAAAAATAATAATCCACAT
                      ____________________________________________________________
consensus GTAGAAATGTACCTTGTTCGTTCTTATGTATCCTATGTAATAAAAAATAATAATCCACAT
 
. : . : . : . : . : . :
rJMFF038B24+ ATAGATTATTATGATGGATAAATCTACATATAAGTGTGTAAAAAAAATGGGTCTAGTTTA
                      ____________________________________________________________
consensus ATAGATTATTATGATGGATAAATCTACATATAAGTGTGTAAAAAAAATGGGTCTAGTTTA