Previous Contig 009981:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004O13Sequence604009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso577009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso
JMFF008D06Sequence487009981 (13)gb:AB117995_15277995e-11Oryza sativa (japonica cultivar-group) bip108 mRNA for BRI1-KD interacting prote732003761 (3)gb:AY087044_15720801e-69Arabidopsis thaliana clone 30996 mRNA, complete sequence.
JMFF011N21Sequence576009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso645009981 (13)sp|Q9M9W1|R22B_ARATH3e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso
JMFF031C09Sequence567009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso656009981 (13)sp|Q9M9W1|R22B_ARATH3e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso
JMFF038B13Sequence404000858 (51)gb:AF464925_18020284e-54Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.731009981 (13)sp|Q9M9W1|R22B_ARATH3e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso
JMFN039F18Sequence548009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso
JMSF019M05Sequence548009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso510009981 (13)sp|Q9M9W1|R22B_ARATH1e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso
JMSF025L05Sequence579009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso528009981 (13)sp|Q9M9W1|R22B_ARATH2e-3460S ribosomal protein L22-2.>gb:ATAC011620_1543309 Arabidopsis thaliana chromoso

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF008D06+ ACGATCAAGGGCTGTCCGGGGGCATAGNCCACGGCGGCTTTGCAAGTT
                      ____________________________________________________________
consensus ACGATCAAGGGCTGTCCGGGGGCATAGNCCACGGCGGCTTTGCAAGTT
 
. : . : . : . : . : . :
JMFF008D06+ ATAACCTTGCCGACCGTACTATCATCATCAACAGGAATATTGGAAGAACTCTTTGCAGAA
                      ____________________________________________________________
consensus ATAACCTTGCCGACCGTACTATCATCATCAACAGGAATATTGGAAGAACTCTTTGCAGAA
 
. : . : . : . : . : . :
JMFF008D06+ TCGTTCTCCAAAGATCCCATTCTGGAACTCATCCAAACAACTGGCCTGCCTGCCTCTCTT
JMSF025L05+ GGTGCAATATCTGATGATCTA
JMSF019M05+ TCTGATGATCTA
rJMFF004O13- TATCTGATGATCTA
JMFF031C09+ TA
JMFF011N21+ TCTA
JMFN039F18+ ATCTA
rJMFF038B13- TCTGATGATCTA
                      ____________________________________________________________
consensus TCGTTCTCCAAAGATCCCATTCTGGAACTCATCCAAACAGGTGGCCTATCTGATGATCTA
 
. : . : . : . : . : . :
JMFF008D06+ CT-TTAAGAATATTCACAGGCCAGTTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
JMSF025L05+ ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
rJMSF019M05- ACATCTGATTCAGAGAATACAT-GTTCAAAC
JMSF019M05+ ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
rJMFF004O13- ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACTT-GTTCAAAC
JMFF031C09+ ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
rJMSF025L05- AAGGTGCAACATCTGATTCAGAGAATACATGGTTCAAAC
JMFF011N21+ ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
JMFN039F18+ ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
rJMFF038B13- ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
                      ____________________________________________________________
consensus ATGAGAAGTAGAGAAAGGAAAAAGGTGCAACATCTGATTCAGAGAATACAT-GTTCAAAC
 
. : . : . : . : . : . :
JMFF008D06+ ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
JMSF025L05+ ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
rJMSF019M05- ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
JMSF019M05+ ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
rJMFF004O13- ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
JMFF031C09+ ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
rJMSF025L05- ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
JMFF011N21+ ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
JMFN039F18+ ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
rJMFF038B13- ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
                      ____________________________________________________________
consensus ACAGGTAATATAATGACAGTTCAAAACTAAAAATACAATACCATCTGGAAAAAAAGAGTG
 
. : . : . : . : . : . :
JMFF008D06+ ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
JMSF025L05+ ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
rJMSF019M05- ATTACTACTCTTAATCTTCGCCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
JMSF019M05+ ATTACTACTCTTAATCTTCGCCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
rJMFF004O13- ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
JMFF031C09+ ATCACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
rJMSF025L05- ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
rJMFF031C09- ATCATTCTCAGCAATGTTGAAGTACCTTAGTT
JMFF011N21+ ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
JMFN039F18+ ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
JMFF004O13+ CTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
rJMFF011N21- ATCATTCTCAGCAATGTTGAAGTACCTTAGTT
rJMFF038B13- ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
                      ____________________________________________________________
consensus ATTACTACTCTTAATCTTCGTCCTCTGCATCATTCTCAGCAATGTTGAAGTACCTTAGTT
 
. : . : . : . : . : . :
JMFF008D06+ CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
JMSF025L05+ CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
rJMSF019M05- CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
JMSF019M05+ CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
rJMFF004O13- CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
JMFF031C09+ CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
rJMSF025L05- CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
rJMFF031C09- CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
JMFF011N21+ CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
JMFN039F18+ CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
JMFF004O13+ CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
rJMFF011N21- CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
rJMFF038B13- CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
                      ____________________________________________________________
consensus CATACACACTTCTATCCTTGTTTGAAGCAATAACACGGAGCCAGTCACGCACATTGTTCT
 
. : . : . : . : . : . :
JMFF008D06+ TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
JMSF025L05+ TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
rJMSF019M05- TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
JMSF019M05+ TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
rJMFF004O13- TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
JMFF031C09+ TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
rJMSF025L05- TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
rJMFF031C09- TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
JMFF011N21+ TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
JMFN039F18+ TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
JMFF004O13+ TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
rJMFF011N21- TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
rJMFF038B13- TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
                      ____________________________________________________________
consensus TCTTTAGGTATTTCTTCGTCAAGTATTTCAAATACCTCTTGGAAAAGTTGGAATCAGAGG
 
. : . : . : . : . : . :
JMFF008D06+ TGACGGTGATCTTTGTCTTGT
JMSF025L05+ TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
rJMSF019M05- TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
JMSF019M05+ TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
rJMFF004O13- TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
JMFF031C09+ TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
rJMSF025L05- TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
rJMFF031C09- TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
JMFF011N21+ TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
JMFN039F18+ TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
JMFF004O13+ TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
rJMFF011N21- TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
rJMFF038B13- TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
                      ____________________________________________________________
consensus TGACGGTGATCTTTGTCTTGTCGCGGGTGACGGTGACAGAGTCGCCGAGGGCTCCGGCCT
 
. : . : . : . : . : . :
JMSF025L05+ TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
rJMSF019M05- TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
JMSF019M05+ TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
rJMFF004O13- TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
JMFF031C09+ TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
rJMSF025L05- TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
rJMFF031C09- TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
JMFF011N21+ TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
JMFN039F18+ TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
JMFF004O13+ TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
rJMFF011N21- TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
rJMFF038B13- TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
                      ____________________________________________________________
consensus TGCCGCCGACCTTGATGCGCTCCTGCAGGAACTTCTCCAGCGATGCAATGTCCATGATCT
 
. : . : . : . : . : . :
JMSF025L05+ TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
rJMSF019M05- TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
JMSF019M05+ TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
rJMFF004O13- TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
JMFF031C09+ TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
rJMSF025L05- TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
rJMFF031C09- TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
JMFF011N21+ TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
JMFN039F18+ TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
JMFF004O13+ TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
rJMFF011N21- TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
rJMFF038B13- TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
                      ____________________________________________________________
consensus TGTCATCGACTGGCTTCGAGCAGTCGATGACGAACGTTGCGCCCTTCTTCTTCCCTCCCT
 
. : . : . : . : . : . :
JMSF025L05+ TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
rJMSF019M05- TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATT
JMSF019M05+ TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATT
rJMFF004O13- TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
JMFF031C09+ TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
rJMSF025L05- TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
rJMFF031C09- TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
JMFF011N21+ TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
JMFN039F18+ TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
JMFF004O13+ TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
rJMFF011N21- TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
rJMFF038B13- TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
                      ____________________________________________________________
consensus TCACGACCCCACTGCTCCCTTTGCTCATCTTGACTCTTTGCCTGAACAAAGTGATTGAAG
 
. : . : . : . : . : . :
JMSF025L05+ TCGGCTGC
rJMFF004O13- TCGGCTGCGATGGATGCTGGGAAT
JMFF031C09+ TCGGCTGCGATGGATGCTGGGAATGT
rJMSF025L05- TCGGCTGC
rJMFF031C09- TCGGCTGCGATGGATGCTGGGAATGT
JMFF011N21+ TCGGCTGCGATGGATGCTGGGAATGT
JMFN039F18+ TCGG
JMFF004O13+ TCGGCTGCGATGGATGCTGGGAAT
rJMFF011N21- TCGGCTGCGATGGATGCTGGGAATGT
rJMFF038B13- TCGGCTGCGATGGATGCTGGGGAGCATGCTCACGGGTCTGTCCATCCTTGGAAATACCAG
                      ____________________________________________________________
consensus TCGGCTGCGATGGATGCTGGGAATGTTGCTCACGGGTCTGTCCATCCTTGGAAATACCAG
 
. : . : . : . : . : . :
rJMFF038B13- CCTCAAAACCACCAGTGGTGGAGTCAATGATGAGGACAGCACAATCTGCCTGTGAGGTAC
                      ____________________________________________________________
consensus CCTCAAAACCACCAGTGGTGGAGTCAATGATGAGGACAGCACAATCTGCCTGTGAGGTAC
 
. : . : . : . : . : . :
rJMFF038B13- CAGTAATCATGTTTTTGATAAAGTCACGATGTCCAGGGGCATCAATGACAGTGCAGTAGT
                      ____________________________________________________________
consensus CAGTAATCATGTTTTTGATAAAGTCACGATGTCCAGGGGCATCAATGACAGTGCAGTAGT