Previous Contig 009980:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038B11Sequence575009980 (4)gb:AC082645_17331711e-65Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence.721009980 (4)gb:AC082645_17331712e-65Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence.
JMSF046B06Sequence711009980 (4)gb:AC082645_17331712e-65Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence.663009980 (4)gb:AC082645_17331712e-65Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038B11- ACTATTCAATCTTCATTTCTCTCTTCCTTCCATACAAATCCCCTTTCAAC
rJMSF046B06+ CCCCTTTCAAC
JMSF046B06- CCCCTTTCAAC
rJMFF038B11+ CAAC
                      ____________________________________________________________
consensus ACTATTCAATCTTCATTTCTCTCTTCCTTCCATACAAATCCCCTTTCAAC
 
. : . : . : . : . : . :
JMFF038B11- TACTCCAAATGCTCCAGGATATGGGTTCTGAGGGTTCATCTGCCGTTGTAGTTCCAAGAA
rJMSF046B06+ TACTCCAAATGCTCCAGGATATGGGTTCTGAGGGTTCATCTGCCGTTGTAGTTCCAAGAA
JMSF046B06- TACTCCAAATGCTCCAGGATATGGGTTCTGAGGGTTCATCTGCCGTTGTAGTTCCAAGAA
rJMFF038B11+ TACTCCAAATGCTCCAGGATATGGGTTCTGAGGGTTCATCTGCCGTTGTAGTTCCAAGAA
                      ____________________________________________________________
consensus TACTCCAAATGCTCCAGGATATGGGTTCTGAGGGTTCATCTGCCGTTGTAGTTCCAAGAA
 
. : . : . : . : . : . :
JMFF038B11- ACTTCAGATTACTAGAAGAACTTGAGAGGGGAGAAAAGGGAATAGGAGATGGAACTGTCA
rJMSF046B06+ ACTTCAGATTACTAGAAGAACTTGAGAGGGGAGAAAAGGGAATAGGAGATGGAACTGTCA
JMSF046B06- ACTTCAGATTACTAGAAGAACTTGAGAGGGGAGAAAAGGGAATAGGAGATGGAACTGTCA
rJMFF038B11+ ACTTCAGATTACTAGAAGAACTTGAGAGGGGAGAAAAGGGAATAGGAGATGGAACTGTCA
                      ____________________________________________________________
consensus ACTTCAGATTACTAGAAGAACTTGAGAGGGGAGAAAAGGGAATAGGAGATGGAACTGTCA
 
. : . : . : . : . : . :
JMFF038B11- GCTATGGAATGGATGATGCTGATGATGTTTACATGCAGTCTTGGACTGGAACAATAATTG
rJMSF046B06+ GCTATGGAATGGATGATGCTGATGATGTTTACATGCAGTCTTGGACTGGAACAATAATTG
JMSF046B06- GCTATGGAATGGATGATGCTGATGATGTTTACATGCAGTCTTGGACTGGAACAATAATTG
rJMFF038B11+ GCTATGGAATGGATGATGCTGATGATGTTTACATGCAGTCTTGGACTGGAACAATAATTG
                      ____________________________________________________________
consensus GCTATGGAATGGATGATGCTGATGATGTTTACATGCAGTCTTGGACTGGAACAATAATTG
 
. : . : . : . : . : . :
JMFF038B11- GTCCTCCAAATACTGTACATGAAGGGCGAATCTACCAGTTGAAGCTGTTCTGCGGACAGG
rJMSF046B06+ GTCCTCCAAATACTGTACATGAAGGGCGAATCTACCAGTTGAAGCTGTTCTGCGGACAGG
JMSF046B06- GTCCTCCAAATACTGTACATGAAGGGCGAATCTACCAGTTGAAGCTGTTCTGCGGACAGG
rJMFF038B11+ GTCCTCCAAATACTGTACATGAAGGGCGAATCTACCAGTTGAAGCTGTTCTGCGGACAGG
                      ____________________________________________________________
consensus GTCCTCCAAATACTGTACATGAAGGGCGAATCTACCAGTTGAAGCTGTTCTGCGGACAGG
 
. : . : . : . : . : . :
JMFF038B11- ACTATCCTGATAAACCACCCAGTGTAAGGTTTCAAACCAGGATAAACATGAGCTGTGTTA
rJMSF046B06+ ATTATCCTGATAAACCACCCAGTGTAAGGTTTCAAACCAGGATAAACATGAGCTGTGTTA
JMSF046B06- ATTATCCTGATAAACCACCCAGTGTAAGGTTTCAAACCAGGATAAACATGAGCTGTGTTA
rJMFF038B11+ ACTATCCTGATAAACCACCCAGTGTAAGGTTTCAAACCAGGATAAACATGAGCTGTGTTA
                      ____________________________________________________________
consensus ATTATCCTGATAAACCACCCAGTGTAAGGTTTCAAACCAGGATAAACATGAGCTGTGTTA
 
. : . : . : . : . : . :
JMFF038B11- ATCAAGAAACTGGTGTGGTTGAACCGATTCTTTTCCCCATGCTTGCTGATTGGAAAAGGG
rJMSF046B06+ ATCAAGAAACTGGTGTGGTTGAACCGATTCTTTTCCCCATGCTTGCTGATTGGAAAAGGG
JMSF046B06- ATCAAGAAACTGGTGTGGTTGAACCGATTCTTTTCCCCATGCTTGCTGATTGGAAAAGGG
rJMFF038B11+ ATCAAGAAACTGGTGTGGTTGAACCGATTCTTTTCCCCATGCTTGCTGATTGGAAAAGGG
                      ____________________________________________________________
consensus ATCAAGAAACTGGTGTGGTTGAACCGATTCTTTTCCCCATGCTTGCTGATTGGAAAAGGG
 
. : . : . : . : . : . :
JMFF038B11- AGCACACAATGGAGGATGTATTATTGCAGTTGAAAAAGGATATGATGTCTCCCCAAAATC
rJMSF046B06+ AGCACACAATGGAGGATGTATTATTGCAGTTGAAAAAGGATATGATGTCTCCCCAAAATC
JMSF046B06- AGCACACAATGGAGGATGTATTATTGCAGTTGAAAAAGGATATGATGTCTCCCCAAAATC
rJMFF038B11+ AGCACACAATGGAGGATGTATTATTGCAGTTGAAAAAGGATATGATGTCTCCCCAAAATC
                      ____________________________________________________________
consensus AGCACACAATGGAGGATGTATTATTGCAGTTGAAAAAGGATATGATGTCTCCCCAAAATC
 
. : . : . : . : . : . :
JMFF038B11- GAAAGCTAGTTCAACCTCCTGAAGCAGGCAACGAAGATGGGCGGGTGGATCAAAAAGGGA
rJMSF046B06+ GAAAGCTAGTTCAACCTCCTGAAGCAGGCAACGAAGATGGGCGGGTGGATCAAAAAGGGA
JMSF046B06- GAAAGCTAGTTCAACCTCCTGAAGCAGGCAACGAAGATGGGCGGGTGGATCAAAAAGGGA
rJMFF038B11+ GAAAGCTAGTTCAACCTCCTGAAGCAGGCAACGAAGATGGGCGGGTGGATCAAAAAGGGA
                      ____________________________________________________________
consensus GAAAGCTAGTTCAACCTCCTGAAGCAGGCAACGAAGATGGGCGGGTGGATCAAAAAGGGA
 
. : . : . : . : . : . :
JMFF038B11- TTGTGCTAAGGTGTTGCATCCTCTAATTGTGAGTATACCATCGAA
rJMSF046B06+ TTGTGCTAAGGTGTTGCATCCTCTAATTGTGAGTATACCATCGAACATCGAGATGTACAT
JMSF046B06- TTGTGCTAAGGTGTTGCATCCTCTAATTGTGAGTATACCATCGAACATCGAGATGTACAT
rJMFF038B11+ TTGTGCTAAGGTGTTGCATCCTCTAATTGTGAGTATACCATCGAACATCGAGATGTACAT
                      ____________________________________________________________
consensus TTGTGCTAAGGTGTTGCATCCTCTAATTGTGAGTATACCATCGAACATCGAGATGTACAT
 
. : . : . : . : . : . :
rJMSF046B06+ AGCCTTTAACAAATAATCTCTTGGAACCCTTAATATATATTATATAACTATATATATATG
JMSF046B06- AGCCTTTAACAAATAATCTCTTGGAACCCTTAATATATATTATATAACTATATATATATG
rJMFF038B11+ AGCCTTTAACAAATAATCTCTTGGAACCCTTAATATATATTATATAAC--TATATATATG
                      ____________________________________________________________
consensus AGCCTTTAACAAATAATCTCTTGGAACCCTTAATATATATTATATAACTATATATATATG
 
. : . : . : . : . : . :
rJMSF046B06+ TAAGCATATGCTGCATGTGTACTTGTANCCTGTGGATACTGATG
JMSF046B06- TAAGCATATGCTGCATGTGTACTTGTA-CCTGTGGATACTGATGTGATATTCCAATTCAC
rJMFF038B11+ TAAGCATATGCTGCATGTGTACTTGTA-CCTGTGGATACTGATGTGATATTCCAATTCAC
                      ____________________________________________________________
consensus TAAGCATATGCTGCATGTGTACTTGTA-CCTGTGGATACTGATGTGATATTCCAATTCAC
 
. : . : . : . : . : . :
JMSF046B06- CTTTATCATACACAATGGCTTGAGAGAT
rJMFF038B11+ CTTTATCATACACAATGGCTTGAGAGATTCAATATCAAATTTCAAATTCTATGAATAAGC
                      ____________________________________________________________
consensus CTTTATCATACACAATGGCTTGAGAGATTCAATATCAAATTTCAAATTCTATGAATAAGC