Previous Contig 009977:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038A13Sequence480006340 (2)gb:AY087689_15727176e-58Arabidopsis thaliana clone 37699 mRNA, complete sequence.672009977 (3)gb:AY087689_15727173e-56Arabidopsis thaliana clone 37699 mRNA, complete sequence.
JMSF009D23Sequence406018609743009977 (3)pir|T00956|T009569e-83translation initiation factor eIF-2 gamma chain F20D22.6 - Arabidopsis thaliana>
JMSF025P14Sequence679006340 (2)gb:AY087689_15727176e-87Arabidopsis thaliana clone 37699 mRNA, complete sequence.754009977 (3)pir|T00956|T009562e-80translation initiation factor eIF-2 gamma chain F20D22.6 - Arabidopsis thaliana>

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009D23+ TCAGNGGTGGCGTAGCTGGTGGCAGTATCTTGAAGGGTGTTTTGA
                      ____________________________________________________________
consensus TCAGNGGTGGCGTAGCTGGTGGCAGTATCTTGAAGGGTGTTTTGA
 
. : . : . : . : . : . :
rJMSF009D23+ AGGTTAANCAAAAAATCGAGGTTCGTCCTGGTATTGTTGTCANGGATGAGAANGGNAACA
rJMSF025P14+ GTCAAGGATGAGAATGGAAACA
                      ____________________________________________________________
consensus AGGTTAANCAAAAAATCGAGGTTCGTCCTGGTATTGTTGTCAAGGATGAGAATGGAAACA
 
. : . : . : . : . : . :
rJMSF009D23+ TCAAATGCACCCCCATATACTCTAGGATAGTTTCATTATACNCTGAGCAGAATGAACTCC
rJMSF025P14+ TCAAATGCACACCTATATACTCTAGGATAGTTTCATTGTATGCTGAGCAGAATGAACTCC
                      ____________________________________________________________
consensus TCAAATGCACCCCTATATACTCTAGGATAGTTTCATTGTATGCTGAGCAGAATGAACTCC
 
. : . : . : . : . : . :
rJMSF009D23+ AATTTGCCGTGCCTGGAGGATTAATTGGAGTTGGCACAACCATGGACCCAACGCTGACAC
rJMSF025P14+ AGTTTGCTGTGCCTGGAGGCTTAATTGGAGTTGGCACAACCATGGACCCCACACTGACAC
rJMFF038A13+ CTGACAC
                      ____________________________________________________________
consensus AGTTTGCTGTGCCTGGAGGCTTAATTGGAGTTGGCACAACCATGGACCCCACGCTGACAC
 
. : . : . : . : . : . :
rJMSF009D23+ GTGCTGATCGATTGGTGGGACAAGTCCTTGNTGAGGTTGGGTCACTTCCAGACATTTTTA
rJMSF025P14+ GTGCTGATCGATTGGTGGGACAAGTCCTTGGTGAGGTTGGGTCACTTCCAGACATTTATA
rJMFF038A13+ GTGGTGATCGATTGGTGGGACAAGTCCTTGGTGAGGTTGGGTCACTTCCAGACATTTATA
                      ____________________________________________________________
consensus GTGCTGATCGATTGGTGGGACAAGTCCTTGGTGAGGTTGGGTCACTTCCAGACATTTATA
 
. : . : . : . : . : . :
rJMSF009D23+ GTGAGCTAGAGGTGAANTTCTTTTTGNTGCGACGCCTTTTGGGTGTCAGANCAAAAGACA
rJMSF025P14+ GTGAGCTAGAGGTGAATTTCTTTCTGTTGCGACGCCTTTTGGGTGTCAGAACAAAAGACA
rJMFF038A13+ GTGAGCTAGAGGTGAATTTCTTTCTGTTGCGACGCCTTTTGGGTGTCAGAACAAAAGACA
                      ____________________________________________________________
consensus GTGAGCTAGAGGTGAATTTCTTTCTGTTGCGACGCCTTTTGGGTGTCAGAACAAAAGACA
 
. : . : . : . : . : . :
rJMSF009D23+ CAGAAAAACAGGGCAAGGTCNCAAAGTTGACAAAGGGAGAAATTTTAATGTTGAATATAG
rJMSF025P14+ CAGAAAAGCAGGGCAAGGTGACCAAGTTGACAAAGGGAGAAATACTAATGTTGAATATAG
rJMFF038A13+ CAGAAAAGCAGGGCAAGGTGACCAAGTTGACAAAGGGAGAAATACTAATGTTGAATATAG
                      ____________________________________________________________
consensus CAGAAAAGCAGGGCAAGGTGACCAAGTTGACAAAGGGAGAAATACTAATGTTGAATATAG
 
. : . : . : . : . : . :
rJMSF009D23+ GATCTATGTCTACTGGAGCTCGTGTCGTTGCCGTCAAGAATGTCTTTGCAAAGCTTCAGT
rJMSF025P14+ GATCTATGTCAACTGGGGCCCGTGTCGTTGCTGTCAAGAATGTGTTTGCAAAACTTCAGT
rJMFF038A13+ GATCTATGTCAACTGGGGCCCGTGTCGTTGCTGTCAAGAATGTGTTTGCAAAACTTCAGT
                      ____________________________________________________________
consensus GATCTATGTCAACTGGGGCCCGTGTCGTTGCTGTCAAGAATGTGTTTGCAAAACTTCAGT
 
. : . : . : . : . : . :
rJMSF009D23+ TGACNTCCCCCGTGTGCACCAGCAANGGCGAGAAAATTGCTCTCNGTCGGAGAATTGAGA
rJMSF025P14+ TGACATCTCCTGTGTGCACCAGCAAAGGTGAGAAAATTGCTCTCAGTCGGAGAATTGAGA
rJMFF038A13+ TGACATCTCCTGTGTGCACCAGCAAAGGTGAGAAAATTGCTCTCAGTCGGAGAATTGAGA
                      ____________________________________________________________
consensus TGACATCTCCTGTGTGCACCAGCAAAGGTGAGAAAATTGCTCTCAGTCGGAGAATTGAGA
 
. : . : . : . : . : . :
rJMSF009D23+ AGCATTGGCGACTTATTGGCTGGGGTCAAATTCAAGCCGGANTTACCCCTGATGTCCCCC
rJMSF025P14+ AGCATTGGCGACTTATTGGTTGGGGCCAAATTCAAGCCGGAATTACTCTTGATGTCCCCT
rJMFF038A13+ AGCATTGGCGACTTATTGGTTGGGGCCAAATTCAAGCCGGAATTACTCTTGATGTCCCCT
                      ____________________________________________________________
consensus AGCATTGGCGACTTATTGGTTGGGGCCAAATTCAAGCCGGAATTACTCTTGATGTCCCCT
 
. : . : . : . : . : . :
rJMSF009D23+ CTGCCCCATNCGAGTGATGTAAGTCAACATTTTTTGGAGAACATGTGAATCTACAAAAGA
rJMSF025P14+ CTGCCCCATTCGAGTGATGTAAGTCAACA-TTTTTGGAGAACTTGTGAATCTACAAAAGA
rJMFF038A13+ CTGCCCCATTCGAGTGATGTAAGTCAACA-TTTTTGGAGAACTTGTGAATCTACAAAAGA
                      ____________________________________________________________
consensus CTGCCCCATTCGAGTGATGTAAGTCAACA-TTTTTGGAGAACTTGTGAATCTACAAAAGA
 
. : . : . : . : . : . :
rJMSF009D23+ CTTGA-ATTTAAAATCATGGGAGGACAAGAAACT
rJMSF025P14+ CTTGAGAGATTAAAACATGGGAGGACAAGAAACTCTGTTGGAAACAACAAAAAAAGAAAA
rJMFF038A13+ CTTGAGAGATTAAAACATGGGAGGACAAGAAACTCTGTTGGAAACAACAAAAAAAGAAAA
                      ____________________________________________________________
consensus CTTGAGAGATTAAAACATGGGAGGACAAGAAACTCTGTTGGAAACAACAAAAAAAGAAAA
 
. : . : . : . : . : . :
rJMSF025P14+ GTCGGTAGAGGAGATATTGATCATTTTGAATTTTGAATACTAAATCACACTATATTGTCT
rJMFF038A13+ GTCGGTAGAGGAGATATTGATCATTTTGAATTTTGAATACTAAATCACACTATATTGTCT
                      ____________________________________________________________
consensus GTCGGTAGAGGAGATATTGATCATTTTGAATTTTGAATACTAAATCACACTATATTGTCT
 
. : . : . : . : . : . :
rJMSF025P14+ GTGTTGTTTTTTCCCAATTATATTTTTCTTTTTCTACTCAACCATATTTGCCTTGTTGGA
rJMFF038A13+ GTGTTGTTTTTTCCCAATTATATTTTTCTTTTTCTACTCAA-CATATTTGCCTTGTTGGA
                      ____________________________________________________________
consensus GTGTTGTTTTTTCCCAATTATATTTTTCTTTTTCTACTCAACCATATTTGCCTTGTTGGA
 
. : . : . : . : . : . :
rJMSF025P14+ GTGTTCTGTATGT
rJMFF038A13+ GTGTTCTGTATGTTGTAATTCATTAGTCTTTTGTGGATGTCAATTTCATCATATGAAGCA
                      ____________________________________________________________
consensus GTGTTCTGTATGTTGTAATTCATTAGTCTTTTGTGGATGTCAATTTCATCATATGAAGCA