Previous Contig 009972:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H06Sequence553000085 (2)gb:AY088311_15733312e-49Arabidopsis thaliana clone 5504 mRNA, complete sequence.655009972 (5)pir|F84823|F848237e-37probable peroxisomal membrane carrier protein [imported] - Arabidopsis thaliana>
JMFF007P11Sequence601000085 (2)gb:AY088311_15733316e-53Arabidopsis thaliana clone 5504 mRNA, complete sequence.719009972 (5)pir|F84823|F848238e-62probable peroxisomal membrane carrier protein [imported] - Arabidopsis thaliana>
JMFF037P05Sequence651009972 (5)pir|F84823|F848231e-35probable peroxisomal membrane carrier protein [imported] - Arabidopsis thaliana>734009972 (5)pir|F84823|F848231e-33probable peroxisomal membrane carrier protein [imported] - Arabidopsis thaliana>
JMFS162B01Sequence626009972 (5)gb:AC135205_17420132e-40Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF007P11+ G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
rJMFF007P11+ GGACTACCAATGCCATACAAGAAGTCTATGATGAAGCTGGATTTTGGGGATTCTGGAAAG
                      ____________________________________________________________
consensus GGACTACCAATGCCATACAAGAAGTCTATGATGAAGCTGGATTTTGGGGATTCTGGAAAG
 
. : . : . : . : . : . :
rJMFF007P11+ GTGTTATCCCAACGTTGATCATGGTAAGCAATCCATCCATACAGTTTATGCTGTATGAGA
                      ____________________________________________________________
consensus GTGTTATCCCAACGTTGATCATGGTAAGCAATCCATCCATACAGTTTATGCTGTATGAGA
 
. : . : . : . : . : . :
rJMFF007P11+ CCCTACTGAAAAAGCTTAGAAAACGGCGTGCCTCCAACAATAAAGCCTCTGATGTTACTG
                      ____________________________________________________________
consensus CCCTACTGAAAAAGCTTAGAAAACGGCGTGCCTCCAACAATAAAGCCTCTGATGTTACTG
 
. : . : . : . : . : . :
rJMFF007P11+ CTTTGGAGATATTTTTGCTTGGTGCATTGGCAAAACTTGGAGCTACTGTCGTAACATATC
rJMFF002H06+ AGATATTTTTGCTTGGTGCATTGGCAAAACTTGGAGCTACTGTCGTAACATATC
JMFS162B01- AGATATTTTTGCTTGGTGCATTGGCAAAACTTGGAGCTACTGTCGTAACATATC
JMFF037P05- AGATATTTTTGCTTGGTGCATTGGCAAAACTTGGAGCTACTGTCGTAACATATC
rJMFF037P05+ AGATATTTTTGCTTGGTGCATTGGCAAAACTTGGAGCTACTGTCGTAACATATC
                      ____________________________________________________________
consensus CTTTGGAGATATTTTTGCTTGGTGCATTGGCAAAACTTGGAGCTACTGTCGTAACATATC
 
. : . : . : . : . : . :
rJMFF007P11+ CTCTTCTGGTTGTTAAGGCTAGACTTCAGGCAAAGCAAGTTCTTGGAGGTGATAAAAGAC
rJMFF002H06+ CTCTTCTGGTTGTTAAGGCTAGACTTCAGGCAAAGCAAGTTCTTGGAGGTGATAAAAGAC
JMFS162B01- CTCTTCTGGTTGTTAAGGCTAGACTTCAGGCAAAGCAAGTTCTTGGAGGTGATAAAAGAC
JMFF037P05- CTCTTCTGGTTGTTAAGGCTAGACTTCAGGCAAAGCAAGTTCTTGGAGGTGATAAAAGAC
rJMFF037P05+ CTCTTNTGGTTGTTAAGGCTAGACTTCAGGCAAAGCAAGTTNTTGGAGGTGATAAAAGAC
                      ____________________________________________________________
consensus CTCTTCTGGTTGTTAAGGCTAGACTTCAGGCAAAGCAAGTTCTTGGAGGTGATAAAAGAC
 
. : . : . : . : . : . :
rJMFF007P11+ ATCAATATAAAGGCACATTCGATGCCATCCTGAAGATGATGAACCATGAAGGTTTCTACG
rJMFF002H06+ ATCAATATAAAGGCACATTCGATGCCATCCTGAAGATGATGAACCATGAAGGTTTTTACG
JMFS162B01- ATCAATATAAAGGCACATTCGATGCCATCCTGAAGATGATGAACCATGAAGGTTTCTACG
JMFF037P05- ATCAATATAAAGGCACATTCGATGCCATCCTGAAGATGATGAACCATGAAGGTTTCTACG
rJMFF037P05+ ATCAATATAAAGGCACATTNGATGCCATCCTGAAGATGATGAACCATGAAGGTTTTTACG
                      ____________________________________________________________
consensus ATCAATATAAAGGCACATTCGATGCCATCCTGAAGATGATGAACCATGAAGGTTTCTACG
 
. : . : . : . : . : . :
rJMFF007P11+ GGTTTTACAAGGGGATGAGCACCAAAATTGTACAGAGTGTTCTCGCAGCTGCTGTATTAT
rJMFF002H06+ GGTTTTACAAGGGGATGAGCACCAAAATTGTACAGAGTGTTNTNGCAGCTGCTGTATTAT
JMFS162B01- GGTTTTACAAGGGGATGAGCACCAAAATTGTACAGAGTGTTCTCGCAGCTGCTGTATTAT
JMFF037P05- GGTTTTACAAGGGGATGAGCACCAAAATTGTACAGAGTGTTCTCGCAGCTGCTGTATTAT
rJMFF037P05+ GGTTTTACAAGGGGATGAGCNCCAAAATTGTACAGAGTGTTNTCGCAGCTGCTGTATTAT
                      ____________________________________________________________
consensus GGTTTTACAAGGGGATGAGCACCAAAATTGTACAGAGTGTTCTCGCAGCTGCTGTATTAT
 
. : . : . : . : . : . :
rJMFF007P11+ TCATGGTGAAGGAAGAACTTGTCCGAGGTGCTAGATGGCTATTAACTGGAGTTCCTGCCA
rJMFF002H06+ TCATGGTGAAGGAAGAACTTGTCCGAGGTGCTAGATGGCTATTAACTGGAGTTCCTGCCA
JMFS162B01- TCATGGTGAAGGAAGAACTTGTCCGAGGTGCTAGATGGCTATTAACTGGAGTTCCTGCCA
JMFF037P05- TCATGGTGAAGGAAGAACTTGTCCGAGGTGCTAGATGGCTATTAACTGGAGTTCCTGCCA
rJMFF037P05+ TCATGGTGAAGGAAGAACTTGTCCGAGGTGCTAGATGGCTATTAACTGGAGTTCCTGCCA
                      ____________________________________________________________
consensus TCATGGTGAAGGAAGAACTTGTCCGAGGTGCTAGATGGCTATTAACTGGAGTTCCTGCCA
 
. : . : . : . : . : . :
rJMFF007P11+ ACTCTACTACATCAAGGCTCCGGTGACAATTGACAAAGGGTTTACCCATATAGTCCACAC
rJMFF002H06+ ACTTTACTACATCAAGGCTCCGGTGACAATTGACAAAGGGTTTACCCATATAGTCCACAC
JMFS162B01- ACTCTACTACATCAAGGCTCCGGTGACAATTGACAAAGGGTTTACCCATATAGTCCACAC
JMFF037P05- ACTCTACTACATCAAGGCTCCGGTGACAATTGACAAAGGGTTTACCCATATAGTCCACAC
rJMFF037P05+ ACTNTACTACATCAAGGCTCCGGTGACAATTGACAAAGGGTTTACCCATATAGTCCACAC
                      ____________________________________________________________
consensus ACTCTACTACATCAAGGCTCCGGTGACAATTGACAAAGGGTTTACCCATATAGTCCACAC
 
. : . : . : . : . : . :
rJMFF007P11+ CAATATCTATGATACTACCCACCCTACAGGTCTATCAGAACCAATCAGAAGTTGGCACTT
rJMFF002H06+ CAATATNTATGATACTACCCACCCTACAGGTNTATCAGAACCAATCAGAAGTTGGCACTT
JMFS162B01- CAATATCTATGATACTACCCACCCTACAGGTCTATCAGAACCAATCAGAAGTTGGCACTT
JMFF037P05- CAATATCTATGATACTACCCACCCTACAGGTCTATCAGAACCAATCAGAAGTTGGCACTT
rJMFF037P05+ CAATATNTATGATACTACCCACCCTACAGGTNTATCAGAACCAATCAGAAGTTGGCACTT
                      ____________________________________________________________
consensus CAATATCTATGATACTACCCACCCTACAGGTCTATCAGAACCAATCAGAAGTTGGCACTT
 
. : . : . : . : . : . :
rJMFF007P11+ GGCAGGAACAACTATCTACAGCATTAGGATTCGTACACTTGTTATTAAGGATAGATCATT
rJMFF002H06+ GGCAGGAACAACTATTTACAGCATTAGGATTNGTACACTTGTTATTAAGGATAGATCATT
JMFS162B01- GGCAGGAACAACTATCTACAGCATTAGGATTCGTACACTTGTTATTAAGGATAGATCATT
JMFF037P05- GGCAGGAACAACTATCTACAGCATTAGGATTCGTACACTTGTTATTAAGGATAGATCATT
rJMFF037P05+ GGCAGGAACAACTATNTACAGCATTAGGATTNGTACACTTGTTATTAAGGATAGATCATT
                      ____________________________________________________________
consensus GGCAGGAACAACTATCTACAGCATTAGGATTCGTACACTTGTTATTAAGGATAGATCATT
 
. : . : . : . : . : . :
rJMFF007P11+ TAAGATTGAAGATTATTAGGGATAATTGTTCCACTTCATTAGGGTTTATTCATAAAT
rJMFF002H06+ TAAGATTGAAGATTATTAGGGATAATTGTTCCACTTCATTAGGGTTTATTCATAAATTGT
JMFS162B01- TAAGATTGAAGATTATTAGGGATAATTGTTCCACTTCATTAGGGTTTATTCATAAATTGT
JMFF037P05- TAAGATTGAAGATTATTAGGGATAATTGTTCCACTTCATTAGGGTTTATTCATAAATTGT
rJMFF037P05+ TAAGATTGAAGATTATTAGGGATAATTGTTCCACTTCATTAGGGTTTATTCATAAATTGT
                      ____________________________________________________________
consensus TAAGATTGAAGATTATTAGGGATAATTGTTCCACTTCATTAGGGTTTATTCATAAATTGT
 
. : . : . : . : . : . :
rJMFF002H06+ AATCAGGCAAAGGTAAAAAAAAAATAAAAATGGACTCAATTTTTGTTTCCTTAACTTGGA
JMFS162B01- AATCAGGC-AAGGTAAAAAAAAAATAAAAATGGACTCAATT
JMFF037P05- AATCAGGCAAAGGTAAAAAAAAAATAAAAATGGACTCAATT
rJMFF037P05+ AATCAGGCAAAGGTAAAAAAAAAATAAAAATGGACTCAATTTTTGTTTCCTTAACTTGGA
                      ____________________________________________________________
consensus AATCAGGCAAAGGTAAAAAAAAAATAAAAATGGACTCAATTTTTGTTTCCTTAACTTGGA
 
. : . : . : . : . : . :
rJMFF002H06+ AGGAGACTGCACGTGGTTATGGATAAGGCCACGCATCGTATTTTATAAATA
rJMFF037P05+ AGGAGACTGCACGTGGTTATGGATAAGGCCACGCATCGTATTTTATAAATATATGAAGAT
                      ____________________________________________________________
consensus AGGAGACTGCACGTGGTTATGGATAAGGCCACGCATCGTATTTTATAAATATATGAAGAT