Previous Contig 009967:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022D10Sequence586009967 (6)gb:AP005301_18501782e-73Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN734009967 (6)gb:AP005728_18567014e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN
JMFF037O08Sequence627009967 (6)gb:AP005728_18567012e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN
JMFN036P23Sequence510009967 (6)gb:AP005728_18567011e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN
JMSF046O04Sequence663009967 (6)gb:AP005301_18501783e-93Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN693009967 (6)gb:AP005728_18567012e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF022D10- AGTACACTCAGCTTCTTCTTCACTGTCCCCTGTATACGGACGGGCGAAACCCTCT
JMSF046O04- GGACGGGCGAAACCCTCT
                      ____________________________________________________________
consensus AGTACACTCAGCTTCTTCTTCACTGTCCCCTGTATACGGACGGGCGAAACCCTCT
 
. : . : . : . : . : . :
JMFF022D10- CCTCCCTAACCTTCTCTCTCCCCATTTCTCCAGCTAGTGCTGAGACCGAGCTACTGCCCA
JMSF046O04- CCTCCCTAACCTTCTCTCTCCCCATTTCTCCAGCTAGTGCTGAGACCGAGCTACTGCCCA
                      ____________________________________________________________
consensus CCTCCCTAACCTTCTCTCTCCCCATTTCTCCAGCTAGTGCTGAGACCGAGCTACTGCCCA
 
. : . : . : . : . : . :
JMFF022D10- GAAAGTGTAGGAGGTTTGATGGCGAAGACCAAACCCGGGAAGAAGGATCTCGATTCGTAC
JMSF046O04- GAAAGTGTAGGAGGTTTGATGGCGAAGACCAAACCCGGGAAGAAGGATCTCGATTCGTAC
                      ____________________________________________________________
consensus GAAAGTGTAGGAGGTTTGATGGCGAAGACCAAACCCGGGAAGAAGGATCTCGATTCGTAC
 
. : . : . : . : . : . :
JMFF022D10- ACAATCAAGGGCACCAACAAAGTCGTCAGGCCCGGTGATTGTGTCTTAATGAGACCATCA
JMSF046O04- ACAATCAAGGGCACCAACAAAGTCGTCAGGCCCGGTGATTGTGTCTTAATGAGACCATCA
                      ____________________________________________________________
consensus ACAATCAAGGGCACCAACAAAGTCGTCAGGCCCGGTGATTGTGTCTTAATGAGACCATCA
 
. : . : . : . : . : . :
JMFF022D10- GATTCAAATAATCTCCCATACGTGGCAAGAGTTGAGAAGTTTGAAGCTGACCACCGGAAC
JMSF046O04- GATTCAAATAATCTCCCATACGTGGCAAGAGTTGAGAAGTTTGAAGCTGACCACCGGAAC
rJMFF022D10+ ACCGGANC
                      ____________________________________________________________
consensus GATTCAAATAATCTCCCATACGTGGCAAGAGTTGAGAAGTTTGAAGCTGACCACCGGAAC
 
. : . : . : . : . : . :
JMFF022D10- AATGTGAAGGTACGAGTGCGGTGGTATTACCGACCTGAGGAATC-AAAGGGTGGCCGCAG
JMSF046O04- AATGTGAAGGTACGAGTGCGGTGGTATTACCGACCTGAGGAATC-AAAGGGTGGCCGCAG
rJMSF046O04+ TACGAGTGCGGTGGTATTACCGACCTGAGGAATCAAAAGGGTGGCCGCAG
rJMFF022D10+ AATGTGAAGGTACGAGTGCGGTGGTATTACCGACNTGAGGAATC-AAAGGGTGGCCGCAG
                      ____________________________________________________________
consensus AATGTGAAGGTACGAGTGCGGTGGTATTACCGACCTGAGGAATC-AAAGGGTGGCCGCAG
 
. : . : . : . : . : . :
JMFF022D10- ACAGTTTCATGGGGCCAAGGAACTATTCTTGTCAGACCACTATGATATACAAAGTGCACA
JMSF046O04- ACAGTTTCATGGGGCCAAGGAACTATTCTTGTCAGACCACTATGATATACAAAGTGCACA
rJMSF046O04+ ACAGTTTCATGGGGCCAAGGAACTATTCTTGTCAGACCACTATGATATACAAAGTGCACA
rJMFF022D10+ ACAGTTTCATGGGGCCAAGGAACTATTCTTGTCAGACCACTATGATATACAAAGTGCACA
                      ____________________________________________________________
consensus ACAGTTTCATGGGGCCAAGGAACTATTCTTGTCAGACCACTATGATATACAAAGTGCACA
 
. : . : . : . : . : . :
JMFF022D10- AACAATTGAAGGAAAGTGCATTGTGCATTCTTTTAAGAACTATACCAAGCTGGATAATGT
JMSF046O04- AACAATTGAAGGAAAGTGCATTGTGCATTCTTTTAAGAACTATACCAAGCTGGATAATGT
rJMSF046O04+ AACAATTGAAGGAAAGTGCATTGTGCATTCTTTTAAGAACTATACCAAGCTGGATAATGT
rJMFF022D10+ AACAATTGAAGGAAAGTGCATTGTGCATTCTTTTAAGAACTATACCAAGCTGGATAATGT
rJMFF037O08+ TTAAGAANTANACCAAGCTGGATAATGT
                      ____________________________________________________________
consensus AACAATTGAAGGAAAGTGCATTGTGCATTCTTTTAAGAACTATACCAAGCTGGATAATGT
 
. : . : . : . : . : . :
JMFF022D10- GGGCGCTGAGGATTACTTCAGTCGATTTGAGTACAAAACTGCCACTGGAGGGTTTACTCC
JMSF046O04- GGGCGCTGAGGATTACTTCAGTCGATTTGAGTACAAAACTGCCACTGGAGGGTTTACTCC
rJMSF046O04+ GGGCGCTGAGGATTACTTCAGTCGATTTGAGTACAAAACTGCCACTGGAGGGTTTACTCC
rJMFF022D10+ GGGCGCTGAGGATTACTTCAGTCGATTTGAGTACAAAACTGCCACTGGAGGGTTTACTCC
rJMFF037O08+ GGGCGNTGAGGATTACTTCAGTCGATTTGAGTACAAAACNGCCNNTGGAGGGTTTNCTCC
                      ____________________________________________________________
consensus GGGCGCTGAGGATTACTTCAGTCGATTTGAGTACAAAACTGCCACTGGAGGGTTTACTCC
 
. : . : . : . : . : . :
JMFF022D10- TGACCGTGTTGCTGTGTATTGCAAGTGTGAGATGCCCTATAATCCTGATGAT
JMSF046O04- TGACCGTGTTGCTGTGTATTGCAAGTGTGAGATGCCCTATAATCCTGATGATCTCATGGT
rJMSF046O04+ TGACCGTGTTGCTGTGTATTGCAAGTGTGAGATGCCCTATAATCCTGATGATCTCATGGT
rJMFF022D10+ TGACCGTGTTGCTGTGTATTGCAAGTGTGAGATGCCCTATAATCCTGATGATCTCATGGT
JMFN036P23- TGCAAGTGTGAGATGCCCTATAATCCTGATGATCTCATGGT
rJMFF037O08+ TGACCGTGTTGCTGTGTATTGCAAGTGTGAGANGCCNTATNATCNTGATGATNTCATGNT
                      ____________________________________________________________
consensus TGACCGTGTTGCTGTGTATTGCAAGTGTGAGATGCCCTATAATCCTGATGATCTCATGGT
 
. : . : . : . : . : . :
JMSF046O04- TCAGTGTGAAGGATGCACAGATTGGTTTCATCCTTCCTGTATGGGGATGACCATTGATGA
rJMSF046O04+ TCAGTGTGAAGGATGCACAGATTGGTTTCATCCTTCCTGTATGGGGATGACCATTGATGA
rJMFF022D10+ TCAGTGTGAAGGATGCACAGATTGGTTTCATCCTTCCTGTATGGGGATGACCATTGATGA
JMFN036P23- TCAGTGTGAAGGATGCACAGATTGGTTTCATCCTTCCTGTATGGGGATGACCATTGATGA
rJMFF037O08+ TCAGTGTGAAGGATGCACAGATTGGTTTCATCCTTCCNGTANGGGGATNACCATTGATGA
                      ____________________________________________________________
consensus TCAGTGTGAAGGATGCACAGATTGGTTTCATCCTTCCTGTATGGGGATGACCATTGATGA
 
. : . : . : . : . : . :
JMSF046O04- AATAAAGAAGTTAGAGCATTTTGTGTGTTCAGACTGCTCAGGT
rJMSF046O04+ AATAAAGAAGTTAGAGCATTTTGTGTGTTCAGACTGCTCAGGTGAAGAGGAGGCTAAAGT
rJMFF022D10+ AATAAAGAAGTTAGAGCATTTTGTGTGTTCAGACTGCTCAGGTGAAGAGGAGGCTAAAGT
JMFN036P23- AATAAAGAAGTTAGAGCATTTTGTGTGTTCAGACTGCTCAGGTGAAGAGGAGGCTAAAGT
rJMFF037O08+ AATAAAGAAGTTAGAGCATTTTGTGTGTTCAGACTNCTCAGGTGAAGAGGAGGNTAAAGT
                      ____________________________________________________________
consensus AATAAAGAAGTTAGAGCATTTTGTGTGTTCAGACTGCTCAGGTGAAGAGGAGGCTAAAGT
 
. : . : . : . : . : . :
rJMSF046O04+ GCAAATGGACTCATTTCGTGTACCTCGGGAGGGGGAGACAAAGCGCCGAAAGAGAACTGG
rJMFF022D10+ GCAAATGGACTCATTTCGTGTACCTCGGGAGGGGGAGACAAAGCGCCGAAAGAGAACTGG
JMFN036P23- GCAAATGGACTCATTTCGTGTACCTCGGGAGGGGGAGACAAAGCGCCGAAAGAGAACTGG
rJMFF037O08+ GCAAATGGNCTCATTTCGTNTNCCTCGGGAGGGGGAGACAAAGCGCCGAAAGAGAACTGG
                      ____________________________________________________________
consensus GCAAATGGACTCATTTCGTGTACCTCGGGAGGGGGAGACAAAGCGCCGAAAGAGAACTGG
 
. : . : . : . : . : . :
rJMSF046O04+ TTGAGCTTTGTGCAGCGGTGGGGGTGCCGGGAGGGAAGGTTTTTCTCTTGGCCAAAGCTC
rJMFF022D10+ TTGAGCTTTGTGCAGCGGTGGGGGTGCCGGGAGGGAAGGTTTTTCTCTTGGCCAAAGCTC
JMFN036P23- TTGAGCTTTGTGCAGCGGTGGGGGTGCCGGGAGGGAAGGTTTTTCTCTTGGCCAAAGCTC
rJMFF037O08+ TTGAGCTTTNTGCAGCGGTGGGGGTGCCGGGAGGGAAGGTTTTTCTCTTGGCCAAAGNTC
                      ____________________________________________________________
consensus TTGAGCTTTGTGCAGCGGTGGGGGTGCCGGGAGGGAAGGTTTTTCTCTTGGCCAAAGCTC
 
. : . : . : . : . : . :
rJMSF046O04+ AGCATTGTTGTTGTGTTGTAAAATTGTACAGTGCTGATGATGCTGAGCTTTTCAACCAAC
rJMFF022D10+ AGCATTGTTGTTGTGTTGTAAAATTGTACAGTGCTGATGATGCTGAGCTTTTCAACCAAC
JMFN036P23- AGCATTGTTGTTGTGTTGTAAAATTGTACAGTGCTGATGATGCTGAGCTTTTCAACCAAC
rJMFF037O08+ AGCATTGTTGTTGTGTTGTAAAATTNTACAGTGNTGATGATGNTGAGCTTTTCAACCAAN
                      ____________________________________________________________
consensus AGCATTGTTGTTGTGTTGTAAAATTGTACAGTGCTGATGATGCTGAGCTTTTCAACCAAC
 
. : . : . : . : . : . :
rJMSF046O04+ TAGTAACTATTGCTTAATTTTGTGTACTAGTTTTGTAATTATGTATGTTATGTGTGTACT
rJMFF022D10+ TAGTAACTATTGCTTAATTTTGTGTACTAGTTTTGTAATTATGTATGTTATGTGTGTACT
JMFN036P23- TAGTAACTATTGCTTAATTTTGTGTACTAGTTTTGTAATTATGTATGTTATGTGTGTACT
rJMFF037O08+ TAGTAACTATTGNNTAATTTTGTGTANTAGTTTNGTAATTANGTATNTTATGTGTGTACT
                      ____________________________________________________________
consensus TAGTAACTATTGCTTAATTTTGTGTACTAGTTTTGTAATTATGTATGTTATGTGTGTACT
 
. : . : . : . : . : . :
rJMSF046O04+ AGACTGAGAATGGTAGCAAACTGATAAACTCCAGTTCTC
rJMFF022D10+ AGACTGAG-ATGGTAGCAAACTGATAAACTCCAGTTCTCTGCCATGTTGTGACCTAAAAA
JMFN036P23- AGACTGAG-ATGGTAGCAAACTGATAAACTCCAGTTCTCTGCCATGTTGTGACCTAAAAA
rJMFF037O08+ AGANTGAG-ATGGTAGCAAANTGATAAACTCCAGTTCTCNGCCATGTTGCGACCTAAAAA
                      ____________________________________________________________
consensus AGACTGAG-ATGGTAGCAAACTGATAAACTCCAGTTCTCTGCCATGTTGTGACCTAAAAA
 
. : . : . : . : . : . :
rJMFF022D10+ GGATAATA
JMFN036P23- GGATAATATAATAGCTGGAGACTTTAGAATCCATTTCAAAATAAATTTTT
rJMFF037O08+ GGATAATATAATAGCTGGAGACTNTAGAATCCATTTCAAAATAAATTTTTAAAAAAAATG
                      ____________________________________________________________
consensus GGATAATATAATAGCTGGAGACTTTAGAATCCATTTCAAAATAAATTTTTAAAAAAAATG