Previous Contig 009963:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037N09Sequence540014825gb:AC104321_17375404e-60Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete sequence.593009963 (2)pir|T52134|T521341e-32Zwille protein [imported] - Arabidopsis thaliana>gb:ART223508_1542068 Arabidopsi
JMFF048K11Sequence378002073 (14)462009963 (2)pir|T52134|T521341e-12Zwille protein [imported] - Arabidopsis thaliana>gb:ART223508_1542068 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037N09+ CAGCCATGCNGGTATCCAGGGGACCAGCCGTCCTGCCCATTACCATGTGCTGT
                      ____________________________________________________________
consensus CAGCCATGCNGGTATCCAGGGGACCAGCCGTCCTGCCCATTACCATGTGCTGT
 
. : . : . : . : . : . :
rJMFF048K11+ CCTTGCAGAACTTGACAAACTGCCTGGGTTACA
rJMFF037N09+ TTGACGAGAACAGATTCNCTGCAGATGCCTTGCAGAACTTGACAAACTGCCTGTGTTACA
                      ____________________________________________________________
consensus TTGACGAGAACAGATTCNCTGCAGATGCCTTGCAGAACTTGACAAACTGCCTGTGTTACA
 
. : . : . : . : . : . :
rJMFF048K11+ CATATGCTCGGGGCCCTAAATCAGTTTCCATTGTTCCCCCGGCATATTATGCCCATTTGG
rJMFF037N09+ CATATGCTCGGTGCANTAAATCAGTNTCCATTGTTCCACNTGCATATTATGCACATTTGG
                      ____________________________________________________________
consensus CATATGCTCGGTGCCCTAAATCAGTTTCCATTGTTCCCCCTGCATATTATGCCCATTTGG
 
. : . : . : . : . : . :
rJMFF048K11+ GGGCCTTTTGAGGTAGGTTTTATGTTGGGGGGGAAATATCAGAGGGATTTTTTGGAAAAT
rJMFF037N09+ CTGCCTTTCGAGNTAGGTATTATGTTGAGGATGAAATATCAGATGGATCTTCTGGAAAGT
                      ____________________________________________________________
consensus GTGCCTTTTGAGGTAGGTTTTATGTTGGGGGTGAAATATCAGATGGATTTTTTGGAAAGT
 
. : . : . : . : . : . :
rJMFF048K11+ CCGGGGGTGGCAGGGGTTCAAGGGGCAGGGATGCTAATGTTAAGCCCTTGCCTATAATCA
rJMFF037N09+ CCGGTGGTGGCAGGGCTACAAGGGACAGGGATGNTAATGTTAAGCCATTGCCTATAATCA
                      ____________________________________________________________
consensus CCGGTGGTGGCAGGGGTTCAAGGGGCAGGGATGCTAATGTTAAGCCCTTGCCTATAATCA
 
. : . : . : . : . : . :
rJMFF048K11+ AGGGCAATGTGAAGGGTGTTATGTTTTTCTGGTGAAGAAAATAATTAGTTGTTTTTCTGG
rJMFF037N09+ AGGNCAATGNGAAGGCTGTTATGTTTTACTGNTGAAGAAAATANTTAGTTGTTTTACTGN
                      ____________________________________________________________
consensus AGGGCAATGTGAAGGGTGTTATGTTTTTCTGGTGAAGAAAATAATTAGTTGTTTTTCTGG
 
. : . : . : . : . : . :
rJMFF048K11+ GGAAGAAAAAAAATTAGTTGTTTTGCTGGGGAAGAAAAATACTTAATTGTTTTTTGCTAT
rJMFF037N09+ TGAAGAAAAATANTTAGTTGTTTTGCTGTGGAAGAAAAGTANTTAATTGTTTTTTGCTAT
                      ____________________________________________________________
consensus TGAAGAAAAATAATTAGTTGTTTTGCTGTGGAAGAAAAGTACTTAATTGTTTTTTGCTAT
 
. : . : . : . : . : . :
rJMFF048K11+ TCAACTTGGGTTTTGTTTAGGGCGGTTTTTTTTGCCCTTTTGGGGAAAGATATCCCAGGA
rJMFF037N09+ TCAACTTGGCTTNTGTTTAGTGCNGTTTTTTTTGCCATCTNGGAGATAGATATCCAAGGA
                      ____________________________________________________________
consensus TCAACTTGGGTTTTGTTTAGTGCGGTTTTTTTTGCCCTTTTGGGGATAGATATCCCAGGA
 
. : . : . : . : . : . :
rJMFF048K11+ TAATTCCAACGTTGGGGTTTTTTCAGGCCCAAAGTCAAGTTTGAAAACAAGAAAATTTTT
rJMFF037N09+ TAATTCAAACGTTGGTGTTTTGTCAGGCACAAAGTCAAGTTTGAAAACAAGANAATTATT
                      ____________________________________________________________
consensus TAATTCCAACGTTGGTGTTTTTTCAGGCCCAAAGTCAAGTTTGAAAACAAGAAAATTTTT
 
. : . : . : . : . : . :
rJMFF048K11+ AACTT
rJMFF037N09+ AACTTCTCGTGTTTTNGCGTATTTATTGTATTTACATATGGTAGATTTCACTTAAAACCA
                      ____________________________________________________________
consensus AACTTCTCGTGTTTTNGCGTATTTATTGTATTTACATATGGTAGATTTCACTTAAAACCA