Previous Contig 009959:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037M07Sequence776009959 (4)gb:BT006192_16390845e-73Arabidopsis thaliana clone C00135 (K) unknown protein (At1g44790) mRNA, complete
JMFN008O24Sequence626009959 (4)gb:BT006192_16390849e-74Arabidopsis thaliana clone C00135 (K) unknown protein (At1g44790) mRNA, complete
JMSF021J16Sequence677009959 (4)gb:BT006192_16390841e-73Arabidopsis thaliana clone C00135 (K) unknown protein (At1g44790) mRNA, complete760009959 (4)gb:BT006192_16390841e-73Arabidopsis thaliana clone C00135 (K) unknown protein (At1g44790) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021J16- GAGTCTCCCTCTCTAGTCTCCTCACCTCTCTCAAGTCTCAA
                      ____________________________________________________________
consensus GAGTCTCCCTCTCTAGTCTCCTCACCTCTCTCAAGTCTCAA
 
. : . : . : . : . : . :
JMSF021J16- ATTGGGTTAGCGATCAGTCTCGGGGAGCGCCAGGACCCAGGAGGGATTTGGTGATGGTGA
JMFN008O24- GGGAGCGCCAGGACCCAGGAGGGATTTGGTGATGGTGA
rJMSF021J16+ GGGTTAGCGATCAGTCTCGGGGAGCGCCAGGACCCAGGAGGGATTTGGTGATGGTGA
rJMFF037M07+ GGGAGCGCCAGGACCCAGGAGGGATTTGGTGATGGTGA
                      ____________________________________________________________
consensus ATTGGGTTAGCGATCAGTCTCGGGGAGCGCCAGGACCCAGGAGGGATTTGGTGATGGTGA
 
. : . : . : . : . : . :
JMSF021J16- TGTGGGTGTTCGGATACGGGTCGCTAATATGGAAACCGGGTTTCCATTACGACGATTGCC
JMFN008O24- TGTGGGTGTTCGGATACGGGTCGCTAATATGGAAACCGGGTTTCCATTACGACGATTGCC
rJMSF021J16+ TGTGGGTGTTCGGATACGGGTCGCTAATATGGAAACCGGGTTTCCATTACGACGATTGCC
rJMFF037M07+ TGTGGGTGTTCGGATACGGGTCGCTAATATGGAAACCGGGTTTCCATTACGACGATTGCN
                      ____________________________________________________________
consensus TGTGGGTGTTCGGATACGGGTCGCTAATATGGAAACCGGGTTTCCATTACGACGATTGCC
 
. : . : . : . : . : . :
JMSF021J16- TCGTGGGTTTCATAAAGGGCTATCGCCGCGTCTTCTACCAAGGCAGTACCGATCACAGAG
JMFN008O24- TCGTGGGTTTCATAAAGGGCTATCGCCGCGTCTTCTACCAAGGCAGTACCGATCACAGAG
rJMSF021J16+ TCGTGGGTTTCATAAAGGGCTATCGCCGCGTCTTCTACCAAGGCAGTACCGATCACAGAG
rJMFF037M07+ TCGTGGGTTTCATAAAGGGCTATCGCCGCGTCTTCTACCAAGGCAGTACCGATCACAGAG
                      ____________________________________________________________
consensus TCGTGGGTTTCATAAAGGGCTATCGCCGCGTCTTCTACCAAGGCAGTACCGATCACAGAG
 
. : . : . : . : . : . :
JMSF021J16- GAACTCCTGAATTCCCGGGTCGAACGGTCACATTGGAGCCTGCAGATGGGGAGGTTTGCT
JMFN008O24- GAACTCCTGAATTCCCGGGTCGAACGGTCACATTGGAGCCTGCAGATGGGGAGGTTTGCT
rJMSF021J16+ GAACTCCTGAATTCCCGGGTCGAACGGTCACATTGGAGCCTGCAGATGGGGAGGTTTGCT
rJMFF037M07+ GAACTCCTGAATTCCCGGGTCGAACGGTCACATTGGAGCCTGCAGATGGGGAGGTTTGCT
                      ____________________________________________________________
consensus GAACTCCTGAATTCCCGGGTCGAACGGTCACATTGGAGCCTGCAGATGGGGAGGTTTGCT
 
. : . : . : . : . : . :
JMSF021J16- GGGGTATTGCCTACAAGATAACTAAAAAGGAAGATCAAGAAGTAGCGATAACGTATCTTG
JMFN008O24- GGGGTATTGCCTACAAGATAACTAAAAAGGAAGATCAAGAAGTAGCGATAACGTATCTTG
rJMSF021J16+ GGGGTATTGCCTACAAGATAACTAAAAAGGAAGATCAAGAAGTAGCGATAACGTATCTTG
rJMFF037M07+ GGGGTATTGCCTACAAGATAACTAAAAAGGAAGATCAAGAAGTAGCGATAACGTATCTTG
                      ____________________________________________________________
consensus GGGGTATTGCCTACAAGATAACTAAAAAGGAAGATCAAGAAGTAGCGATAACGTATCTTG
 
. : . : . : . : . : . :
JMSF021J16- AAGTGAGGGAAAAGCAGTATGACAAGAAGGCCTATTTGGATCTTTTCACTGATTTAAAAG
JMFN008O24- AAGTGAGGGAAAAGCAGTATGACAAGAAGGCCTATTTGGATCTTTTCACTGATTTAAAAG
rJMSF021J16+ AAGTGAGGGAAAAGCAGTATGACAAGAAGGCCTATTTGGATCTTTTCACTGATTTAAAAG
rJMFF037M07+ AAGTGAGGGAAAAGCAGTATGACAAGAAGGCCTATTTGGATCTTTTCACTGATTTAAAAG
                      ____________________________________________________________
consensus AAGTGAGGGAAAAGCAGTATGACAAGAAGGCCTATTTGGATCTTTTCACTGATTTAAAAG
 
. : . : . : . : . : . :
JMSF021J16- CTTCAACTCCAGCCGTTTCTGATGTACTGGTATATGTAGCATCTCCGGACAAGACAATCA
JMFN008O24- CTTCAACTCCAGCCGTTTCTGATGTACTGGTATATGTAGCATCTCCGGACAAGACAATCA
rJMSF021J16+ CTTCAACTCCAGCCGTTTCTGATGTACTGGTATATGTAGCATCTCCGGACAAGACAATCA
rJMFF037M07+ CTTCAACTCCAGCCGTTTCTGATGTACTGGTATATGTAGCATCTCCGGACAAGACAATCA
                      ____________________________________________________________
consensus CTTCAACTCCAGCCGTTTCTGATGTACTGGTATATGTAGCATCTCCGGACAAGACAATCA
 
. : . : . : . : . : . :
JMSF021J16- ACAAAAATTACTTGGGGCCTGCATCAATTGAAGAAATTGCCAGTCAAATCGTTCGTGCTG
JMFN008O24- ACAAAAATTACTTGGGGCCTGCATCAATTGAAGAAATTGCCAGTCAAATCGTTCGTGCTG
rJMSF021J16+ ACAAAAATTACTTGGGGCCTGCATCAATTGAAGAAATTGCCAGTCAAATCGTTCGTGCTG
rJMFF037M07+ ACAAAAATTACTTGGGGCCTGCATCAATTGAAGAAATTGCCAGTCAAATCGTTCGTGCTG
                      ____________________________________________________________
consensus ACAAAAATTACTTGGGGCCTGCATCAATTGAAGAAATTGCCAGTCAAATCGTTCGTGCTG
 
. : . : . : . : . : . :
JMSF021J16- AAGGGCCTTCTGGACCGAACAGAGATTACCTTTTTCAACTTGAGAAAGCGCTCGGTCTGA
JMFN008O24- AAGGGCCTTCTGGACCGAACAGAGATTACCTTTTTCAACTTGAGAAAGCGCTCGGTCTGA
rJMSF021J16+ AAGGGCCTTCTGGACCGAACAGAGATTACCTTTTTCAACTTGAGAAAGCGCTCGGTCTGA
rJMFF037M07+ AAGGGCCTTCTGGACCGAACAGAGATTACCTTTTTCAACTTGAGAAAGCGCTCGGTCTGA
                      ____________________________________________________________
consensus AAGGGCCTTCTGGACCGAACAGAGATTACCTTTTTCAACTTGAGAAAGCGCTCGGTCTGA
 
. : . : . : . : . : . :
JMSF021J16- TAGGGTGTGAAGACAAACACGTTACTGACCTCGCTAAGGAGGTGCGACGCATCATTGGGG
JMFN008O24- TAGGGTGTGAAGACAAACACGTTACTGACCTCGCTAAGGAGGTGCGACGCATCATTGGGG
rJMSF021J16+ TAGGGTGTGAAGACAAACACGTTACTGACCTCGCTAAGGAGGTGCGACGCATCATTGGGG
rJMFF037M07+ TAGGGTGTGAAGACAAACACGTTACTGACCTCGCTAAGGAGGTGCGACGCATCATTGGGG
                      ____________________________________________________________
consensus TAGGGTGTGAAGACAAACACGTTACTGACCTCGCTAAGGAGGTGCGACGCATCATTGGGG
 
. : . : . : . : . : . :
JMSF021J16- AGACAATTCCNATCTGAGTGGCTAGTGGCCCGGCCA
JMFN008O24- AGACAATTCCAATCTGAGTGGCTAGTGGCCCGGCCA
rJMSF021J16+ AGACAATTCCAATCTGAGTGGCTAGTGGCCCGGCCAGGAAAGACTTTCTTGAGCCTTATA
rJMFF037M07+ AGACAATTCCAATCTGAGTGGCTAGTGGCCCGGCCAGGAAAGACTTTCTTGAGCCTTATA
                      ____________________________________________________________
consensus AGACAATTCCAATCTGAGTGGCTAGTGGCCCGGCCAGGAAAGACTTTCTTGAGCCTTATA
 
. : . : . : . : . : . :
rJMSF021J16+ GTTATGGATATGGAAAAGACCAAAACTAAAACATAATTACTTGTGCCTAATATTCTCAGC
rJMFF037M07+ GTTATGGATATGGAAAAGACCAAAACTAAAACATAATTACTTGTGCCTAATATTCTCAGC
                      ____________________________________________________________
consensus GTTATGGATATGGAAAAGACCAAAACTAAAACATAATTACTTGTGCCTAATATTCTCAGC
 
. : . : . : . : . : . :
rJMSF021J16+ ATGTGTAATTACTTCTCAATTTATTTCTTGACGCCAACAC
rJMFF037M07+ ATGTGTAATTACTTCTCAATTTATTTCTTGACGCCAACACTTCATAAATAATTAAAGACA
                      ____________________________________________________________
consensus ATGTGTAATTACTTCTCAATTTATTTCTTGACGCCAACACTTCATAAATAATTAAAGACA