Previous Contig 009946:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037G24Sequence592003810 (4)gb:AB016886_15131312e-54Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23.719009946 (2)pir|T05949|T059492e-30phosphatidylinositol-phosphatidylcholine transfer protein SEC14 homolog Ssh1 - s
JMFN011I19Sequence613009946 (2)gb:AY079108_15681692e-16Arabidopsis thaliana At1g55840/F14J16_2 mRNA, complete cds.>gb:AF419577_1798439

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN011I19+ TAGAATAGAACCTGAGATAGCCACACATCTGC
rJMFF037G24- CTTTATAAATTTGATAGTGTAATACAATAGAATAGAACCTGAGATAGCCACACATCTGC
                      ____________________________________________________________
consensus CTTTATAAATTTGATAGTGTAATACAATAGAATAGAACCTGAGATAGCCACACATCTGC
 
. : . : . : . : . : . :
JMFN011I19+ TTTACATTATTCGCCAATATCTTCCATGTCTAAACATCAATATAACTCGATCCCTATGTA
rJMFF037G24- TTTACATTATTCGCCAATATCTTCCATGTCTAAACATCAATATAACTCGATCCCTATGTA
                      ____________________________________________________________
consensus TTTACATTATTCGCCAATATCTTCCATGTCTAAACATCAATATAACTCGATCCCTATGTA
 
. : . : . : . : . : . :
JMFN011I19+ CACCTCACAGTACACCCAAACAAACTTATAGTTTCAAATTCGAGGATGCAACTTGCATGT
rJMFF037G24- CACCTCACAGTACACCCAAACAAACTTATAGTTTCAAATTCGAGGATGCAACTTGCATGT
                      ____________________________________________________________
consensus CACCTCACAGTACACCCAAACAAACTTATAGTTTCAAATTCGAGGATGCAACTTGCATGT
 
. : . : . : . : . : . :
JMFN011I19+ TAGCTTACACATATAATATATATATATATAAGTCTATGTTGTAGGGAAAAAAAGATCTAG
rJMFF037G24- TAGCTTACACATATAATATATATATATATAAGTCTATGTTGTAGGGAAAAAAAGATCTAG
                      ____________________________________________________________
consensus TAGCTTACACATATAATATATATATATATAAGTCTATGTTGTAGGGAAAAAAAGATCTAG
 
. : . : . : . : . : . :
JMFN011I19+ TATAAGCTACTTCTCTACACGAAAGAAAGACGTTGGTTAGAAGGTAGAGCATCCAAGTCG
rJMFF037G24- TATAAGCTACTTCTCTACACGAAAGAAAGACGTTGGTTAGAAGGTAGAGCATCCAAGTCG
                      ____________________________________________________________
consensus TATAAGCTACTTCTCTACACGAAAGAAAGACGTTGGTTAGAAGGTAGAGCATCCAAGTCG
 
. : . : . : . : . : . :
JMFN011I19+ ATAACGGACAACTACAGACATCACCAGAGCCCAATCGAGCAGCAAAAGAAACAATAACAG
rJMFF037G24- ATAACGGACAACTACAGACATCACCAGAGCCCAATCGAGCAGCAAAAGAAACAATAACAG
                      ____________________________________________________________
consensus ATAACGGACAACTACAGACATCACCAGAGCCCAATCGAGCAGCAAAAGAAACAATAACAG
 
. : . : . : . : . : . :
JMFN011I19+ AGAACTCAACTCTTTATCAATGGCGATTGTTAATTTTCAGGTCTTCCATTGACTCGGCAA
rJMFF037G24- AGAACTCAACTCTTTATCAATGGCGATTGTTAATTTTCAGGTCTTCCATTGACTCGGCAA
                      ____________________________________________________________
consensus AGAACTCAACTCTTTATCAATGGCGATTGTTAATTTTCAGGTCTTCCATTGACTCGGCAA
 
. : . : . : . : . : . :
JMFN011I19+ GCCCATCTTGGTTTCCAAGTTTTTGTAACTCGGATGCCATTGTCTTGACGAGCTCTGTTC
rJMFF037G24- GCCCATCTTGGTTTCCAAGTTTTTGTAACTCGGATGCCATTGTCTTGACGAGCTCTGTTC
                      ____________________________________________________________
consensus GCCCATCTTGGTTTCCAAGTTTTTGTAACTCGGATGCCATTGTCTTGACGAGCTCTGTTC
 
. : . : . : . : . : . :
JMFN011I19+ CTTCTGTGTCAGTCTCGGGGAAATCCACATGAACAGAGCCCTGTTTTAGTGGACCCCGAG
rJMFF037G24- CTTCTGTGTCAGTCTCGGGGAAATCCACATGAACAGAGCCCTGTTTTAGTGGACCCCGAG
                      ____________________________________________________________
consensus CTTCTGTGTCAGTCTCGGGGAAATCCACATGAACAGAGCCCTGTTTTAGTGGACCCCGAG
 
. : . : . : . : . : . :
JMFN011I19+ GCTCGCGAATTAACGACTGCTGCTTCATGTAATTGTAATGTTGGTGGTGAAAGGGATGGT
rJMFF037G24- GCTCGCGAATTAACGACTGCTGCTTCATGTAATTGTAATGTTGGTGGTGAAAGGGATGGT
                      ____________________________________________________________
consensus GCTCGCGAATTAACGACTGCTGCTTCATGTAATTGTAATGTTGGTGGTGAAAGGGATGGT
 
. : . : . : . : . : . :
JMFN011I19+ CCAAGGAGAAGCAATTTTCAAATGACCCTTCGGAATATCGG
rJMFF037G24- CCAAGGAGAAGCAATTTTCAAATGACCCTTCGGAATATCGGGAAGAACCCGAACCTTGCC
                      ____________________________________________________________
consensus CCAAGGAGAAGCAATTTTCAAATGACCCTTCGGAATATCGGGAAGAACCCGAACCTTGCC
 
. : . : . : . : . : . :
rJMFF037G24- TACGACAAAAGTGGGGGAGAGACGAGTAGTCCATTATCTTCAACAGATCATCTTGTCCAC
                      ____________________________________________________________
consensus TACGACAAAAGTGGGGGAGAGACGAGTAGTCCATTATCTTCAACAGATCATCTTGTCCAC