Previous Contig 009944:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037G13Sequence703009944 (2)pir|T08540|T085402e-13hypothetical protein F27B13.30 - Arabidopsis thaliana>gb:ATCHRIV71_1546900 Arabi
JMSF027P18Sequence631006501 (2)pir|T08540|T085403e-18hypothetical protein F27B13.30 - Arabidopsis thaliana>gb:ATCHRIV71_1546900 Arabi729009944 (2)pir|T08540|T085403e-18hypothetical protein F27B13.30 - Arabidopsis thaliana>gb:ATCHRIV71_1546900 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027P18+ TAGAAATGGATCTACTAAAATTGGTCGGCCCGCA
                      ____________________________________________________________
consensus TAGAAATGGATCTACTAAAATTGGTCGGCCCGCA
 
. : . : . : . : . : . :
rJMSF027P18+ TCGGGCAATGCTAAGGGAGAAAGGAAGCCTAAAGCAAAACCCAAGCAGAAAACTACTCAG
rJMFF037G13+ AGAAAGGAAGCNTAAAGCAAAACCCAAGCAGAAAACTACTCAG
                      ____________________________________________________________
consensus TCGGGCAATGCTAAGGGAGAAAGGAAGCCTAAAGCAAAACCCAAGCAGAAAACTACTCAG
 
. : . : . : . : . : . :
rJMSF027P18+ CTCTCTACTTCTCTCAATGGTCTAGTTGGCAAGATACCGGAGCAATCCAAGCCAACAGGG
rJMFF037G13+ CTCTCTACTTCTCTCAATGGTCTAGTTGGCAAGATACCGGAGCAATCCAAGCCAACAGGG
                      ____________________________________________________________
consensus CTCTCTACTTCTCTCAATGGTCTAGTTGGCAAGATACCGGAGCAATCCAAGCCAACAGGG
 
. : . : . : . : . : . :
rJMSF027P18+ CCTTCAATAGCAAAAGCAAGTGAGTTTAGCTCAAATGGCACTCCCAAGGATAAGAATGAC
rJMFF037G13+ CNTTCAATAGCAAAAGCAAGTGAGTTTAGCTCAAATGGCACTCCCAAGGATAAGAATGAC
                      ____________________________________________________________
consensus CCTTCAATAGCAAAAGCAAGTGAGTTTAGCTCAAATGGCACTCCCAAGGATAAGAATGAC
 
. : . : . : . : . : . :
rJMSF027P18+ TGTAACTCTGAAGAATTGGAGGACCCCATTGATTTATCTGGATTACAACTACCCGGAATG
rJMFF037G13+ TGTAACTCTGAAGAATTGGAGGACCCCATTGATTTATCTGGATTACAACTACCCGGAATG
                      ____________________________________________________________
consensus TGTAACTCTGAAGAATTGGAGGACCCCATTGATTTATCTGGATTACAACTACCCGGAATG
 
. : . : . : . : . : . :
rJMSF027P18+ GATGTTTTAGGTGTTCCTGAGGATCTTGGTGGCCAGGGACAGGATATAGGATCTTGGTTG
rJMFF037G13+ GATGTTTTAGGTGTTCCTGAGGATCTTGGTGGCCAGGGACAGGATATAGGATCTTGGTTG
                      ____________________________________________________________
consensus GATGTTTTAGGTGTTCCTGAGGATCTTGGTGGCCAGGGACAGGATATAGGATCTTGGTTG
 
. : . : . : . : . : . :
rJMSF027P18+ AACTTTGATGATGATGGATTACAAGATCATGATTTCATGGGACTTGAGATTCCAATGGAT
rJMFF037G13+ AACTTTGATGATGATGGATTACAAGATCATGATTTCATGGGACTTGAGATTCCAATGGAT
                      ____________________________________________________________
consensus AACTTTGATGATGATGGATTACAAGATCATGATTTCATGGGACTTGAGATTCCAATGGAT
 
. : . : . : . : . : . :
rJMSF027P18+ GATCTCTCAGACTTGAATATGCTAGTTTGAAGTTGCATTTGTTGTATATTCCTGTTCATT
rJMFF037G13+ GATCTCTCAGACTTGAATATGCTAGTTTGAAGTTGCATTTGTTGTATATTCCTGTTCATT
                      ____________________________________________________________
consensus GATCTCTCAGACTTGAATATGCTAGTTTGAAGTTGCATTTGTTGTATATTCCTGTTCATT
 
. : . : . : . : . : . :
rJMSF027P18+ ATACGCTCACAGAAGAAACCTCGTTGTTGTTGAGAATGCCCAGATACATGTGGGTCATGC
rJMFF037G13+ ATACGCTCACAGAAGAAACCTCGTTGTTGTTGAGAATGCCCAGATACATGTGGGTCATGC
                      ____________________________________________________________
consensus ATACGCTCACAGAAGAAACCTCGTTGTTGTTGAGAATGCCCAGATACATGTGGGTCATGC
 
. : . : . : . : . : . :
rJMSF027P18+ GACTGTTACATCCATTATTAGGGGTATACATTCTTTTAAACAATCGTGCGCAAGTCCACT
rJMFF037G13+ GACTGTTACATCCATTATTAGGGGTATACATTCTTTTAAACAATCGTGCGCAAGTCCACT
                      ____________________________________________________________
consensus GACTGTTACATCCATTATTAGGGGTATACATTCTTTTAAACAATCGTGCGCAAGTCCACT
 
. : . : . : . : . : . :
rJMSF027P18+ TTGAGTGAACCCTTCAAATCCTGTGGGTTTGTTCCTTAAGTTTATGACTTCGACTGTAAA
rJMFF037G13+ TTGAGTGAACCCTTCAAATCCTGTGGGTTTGTTCCTTAAGTTTATGACTTCGACTGTAAA
                      ____________________________________________________________
consensus TTGAGTGAACCCTTCAAATCCTGTGGGTTTGTTCCTTAAGTTTATGACTTCGACTGTAAA
 
. : . : . : . : . : . :
rJMSF027P18+ GATCTTTTTGTACAACATCAAAGCTAGTATCTTAGTTATAGTGTCTTAGAAAAAGCTGTA
rJMFF037G13+ GATCTTTTTGTACAACATCAAAGCTAGTATCTTAGTTATAGTGTCTTAGAAAAAGCTGTA
                      ____________________________________________________________
consensus GATCTTTTTGTACAACATCAAAGCTAGTATCTTAGTTATAGTGTCTTAGAAAAAGCTGTA
 
. : . : . : . : . : . :
rJMSF027P18+ TTTTGGTTTTAGCAATACAGGCCAGGGGACATCTC
rJMFF037G13+ TTTTGGTTTTAGCAATACAGGCCAGGGGACATCTCTGTATATAAGTTAATTTCAATAAAA
                      ____________________________________________________________
consensus TTTTGGTTTTAGCAATACAGGCCAGGGGACATCTCTGTATATAAGTTAATTTCAATAAAA