Previous Contig 009935:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003G17Sequence547005143 (19)gb:AY099744_15767694e-41Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl703009935 (17)gb:AY099744_15767697e-42Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF005A12Sequence462005143 (19)gb:AY099744_15767695e-37Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl705009935 (17)gb:AY099744_15767697e-42Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF005D13Sequence457005143 (19)gb:AY099744_15767693e-36Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl685009935 (17)gb:AY099744_15767693e-45Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF007G05Sequence620005143 (19)gb:AY099744_15767699e-55Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl694009935 (17)gb:AY099744_15767693e-42Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF016O05Sequence552005143 (19)gb:AY099744_15767692e-36Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl802009935 (17)gb:AY099744_15767696e-53Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF025L01Sequence518005143 (19)gb:AY099744_15767693e-46Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl674009935 (17)gb:AY099744_15767698e-45Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF030K07Sequence458005143 (19)gb:AY099744_15767695e-37Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl693009935 (17)gb:AY099744_15767693e-42Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF033C07Sequence335005143 (19)gb:AY099744_15767691e-08Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl725009935 (17)gb:AY099744_15767693e-45Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF033C20Sequence549005143 (19)gb:AY099744_15767697e-44Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl718009935 (17)gb:AY099744_15767691e-43Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF037B24Sequence578005143 (19)gb:AY099744_15767692e-49Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl750009935 (17)gb:AY099744_15767692e-39Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMFF049A08Sequence644005143 (19)gb:AY099744_15767691e-57Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl469009935 (17)gb:AC091302_17347591e-14Oryza sativa chromosome 3 BAC OSJNBb0015I21 genomic sequence, complete sequence.
JMFF049M02Sequence645005143 (19)gb:AY099744_15767693e-57Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl574009935 (17)gb:AC091302_17347597e-22Oryza sativa chromosome 3 BAC OSJNBb0015I21 genomic sequence, complete sequence.
JMFF050P13Sequence618005143 (19)gb:AY099744_15767693e-51Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl543009935 (17)gb:AC091302_17347596e-19Oryza sativa chromosome 3 BAC OSJNBb0015I21 genomic sequence, complete sequence.
JMFF051B17Sequence609005143 (19)gb:AY099744_15767693e-51Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl494009935 (17)gb:AC091302_17347599e-20Oryza sativa chromosome 3 BAC OSJNBb0015I21 genomic sequence, complete sequence.
JMSF010E09Sequence498005143 (19)gb:AY099744_15767692e-19Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl563009935 (17)gb:AC091302_17347595e-24Oryza sativa chromosome 3 BAC OSJNBb0015I21 genomic sequence, complete sequence.
JMSF011N18Sequence291005143 (19)gb:AY099744_15767692e-05Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl707009935 (17)gb:AY099744_15767697e-42Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl
JMSF028B08Sequence686008557 (12)gb:AY136389_15818909e-63Arabidopsis thaliana unknown protein (At1g19110) mRNA, complete cds.>gb:BT000188731009935 (17)gb:AY099744_15767694e-45Arabidopsis thaliana integral membrane protein, putative (At3g21690) mRNA, compl

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016O05+ TTTTATGATATCGGTTGGATTCAATGCAGC
                      ____________________________________________________________
consensus TTTTATGATATCGGTTGGATTCAATGCAGC
 
. : . : . : . : . : . :
rJMFF033C20+ CATTCT
rJMSF028B08+ CAGCATTCT
rJMFF016O05+ AGCAAGTGTGAGGGTGAGCAATGAACTGGGAGCAGGACACCCAAAGTCGGGCAGCATTCT
                      ____________________________________________________________
consensus AGCAAGTGTGAGGGTGAGCAATGAACTGGGAGCAGGACACCCAAAGTCGGGCAGCATTCT
 
. : . : . : . : . : . :
rJMFF033C20+ CAGTGGTGGTCGTGAACTTGATCTCTTTCATAATCTCGGTGATAGCCGCCATTGTTGTCC
rJMSF028B08+ CAGTGGTGGTCGTGAACTTGATCTCTTTCATAATCTCGGTGATAGCCGCCATTGTTGTCC
rJMFF016O05+ CAGTGGTGGTCGTGAACTTGATCTCTTTCATAATCTCGGTGATAGCCGCCATTGTTGTCC
rJMFF005D13+ ATCTCGGTGATAGCCGCCATTGTTGTCC
rJMFF025L01+ TGATAGCCGCCATTGTTGTCC
rJMFF003G17+ CTTTCATAATCTCGGTGATAGCCGCCATTGTTGTCC
rJMSF011N18+ TTCATAATCTCGGTGATAGCCGCCATTGTTGTCC
rJMFF005A12+ ATAATCTCGGTGATAGCCGCCATTGTTGTCC
rJMFF033C07+ AATCTCGGTGATAGCCGCCATTGTTGTCC
                      ____________________________________________________________
consensus CAGTGGTGGTCGTGAACTTGATCTCTTTCATAATCTCGGTGATAGCCGCCATTGTTGTCC
 
. : . : . : . : . : . :
rJMFF033C20+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMSF028B08+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF016O05+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF005D13+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF025L01+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF003G17+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMSF011N18+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF005A12+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF030K07+ GCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF007G05+ GCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF033C07+ TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
rJMFF037B24+ TTCACAGACGGAGAAGTTGTGGCCGATGCTG
                      ____________________________________________________________
consensus TTGCTTTGCGTCACGTTATCAGCTATGTGTTCACAGACGGAGAAGTTGTGGCCGATGCTG
 
. : . : . : . : . : . :
rJMFF033C20+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMSF028B08+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF016O05+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF005D13+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF025L01+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF003G17+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMSF011N18+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMSF010E09+ GTCCAACCTGTAT
rJMFF005A12+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF030K07+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF007G05+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF033C07+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
rJMFF037B24+ TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
                      ____________________________________________________________
consensus TTTCCGATCTCTGTCCGTTGCTTGCACTTACCCTCGTTCTCAACGGGGTCCAACCTGTAT
 
. : . : . : . : . : . :
rJMFF033C20+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMSF028B08+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF016O05+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF005D13+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF025L01+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF003G17+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMSF011N18+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMSF010E09+ TATCCTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF005A12+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF030K07+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF007G05+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF033C07+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF049M02+ TGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
rJMFF050P13+ GTCAATGTTGGC
rJMFF037B24+ TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
                      ____________________________________________________________
consensus TAT-CTGGCGTGGCGGTTGGATGCGGGTGGCAAACGTTCGTTGCATATGTCAATGTTGGC
 
. : . : . : . : . : . :
rJMFF033C20+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMSF028B08+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF016O05+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF005D13+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF025L01+ CGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF003G17+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMSF011N18+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMSF010E09+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF005A12+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF030K07+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF007G05+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF033C07+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCGGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF049M02+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF050P13+ CGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
rJMFF051B17+ TGGGATTTTATTTCAACTTAGGC
rJMFF037B24+ TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
                      ____________________________________________________________
consensus TGCTATTACGTAGTCGGAGTTCCTGTAGGAGCAGTCTTGGGATTTTATTTCAACTTAGGC
 
. : . : . : . : . : . :
rJMFF033C20+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMSF028B08+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF016O05+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF005D13+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF025L01+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF003G17+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMSF011N18+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMSF010E09+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF005A12+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF030K07+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF007G05+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF033C07+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF049M02+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF050P13+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF051B17+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
rJMFF049A08+ TAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGCCCATCATTTTGTTG
rJMFF037B24+ GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
                      ____________________________________________________________
consensus GCTAAGGGTATATGGTGTGGAATGATTGGTGGGACAGTGATGCAGACCATCATTTTGTTG
 
. : . : . : . : . : . :
rJMFF033C20+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMSF028B08+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF016O05+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAGGTAGCGAAGAAAAGATTGAAT
rJMFF005D13+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF025L01+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF003G17+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMSF011N18+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMSF010E09+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF005A12+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF030K07+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF007G05+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF033C07+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF049M02+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF050P13+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF051B17+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF049A08+ TGGGTCCCAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
rJMFF037B24+ TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
                      ____________________________________________________________
consensus TGGGTCACAATTCGAACGGATTGGGTCAAAGAGGTGGAAGTAGCGAAGAAAAGATTGAAT
 
. : . : . : . : . : . :
rJMFF033C20+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMSF028B08+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF016O05+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF005D13+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF025L01+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF003G17+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMSF011N18+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMSF010E09+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF005A12+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF030K07+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF007G05+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF033C07+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF049M02+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF050P13+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF051B17+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
rJMFF049A08+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGCCCTGAAAGAGGAGCATCCACGAA
rJMFF037B24+ CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
                      ____________________________________________________________
consensus CAGTGGGATGCAAAAAGGGAACCCCTTTTGCCGAAGACCTGAAAGAGGAGCATACACGAA
 
. : . : . : . : . : . :
rJMFF033C20+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMSF028B08+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF016O05+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF005D13+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF025L01+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF003G17+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMSF011N18+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMSF010E09+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF005A12+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF030K07+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF007G05+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF033C07+ GCAAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF049M02+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF050P13+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF051B17+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF049A08+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
rJMFF037B24+ ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
                      ____________________________________________________________
consensus ACGAAGTTATTGCTTCGCATTAATTCTTTCCCTGGCGGGATTGCCGATTAATTAGTGAAC
 
. : . : . : . : . : . :
rJMFF033C20+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMSF028B08+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF016O05+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF005D13+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF025L01+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF003G17+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMSF011N18+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMSF010E09+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF005A12+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF030K07+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF007G05+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF033C07+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF049M02+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF050P13+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF051B17+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF049A08+ TAAAAGGTGTTTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
rJMFF037B24+ TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
                      ____________________________________________________________
consensus TAAAAGGTGTCTGGTAAACTAGCTGCGGCTGAGATGAGATCTGGCGATGTTGTGTATTTT
 
. : . : . : . : . : . :
rJMFF033C20+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMSF028B08+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF016O05+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGGT
rJMFF005D13+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF025L01+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF003G17+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMSF011N18+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMSF010E09+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF005A12+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF030K07+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF007G05+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF033C07+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF049M02+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF050P13+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF051B17+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
rJMFF049A08+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCACCAGAT
rJMFF037B24+ GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
                      ____________________________________________________________
consensus GAGTCAGGAATGTGGGCAGGAAATTTAGACTCGAGGAAGTTTAATGTTGTGTCAACAGAT
 
. : . : . : . : . : . :
rJMFF033C20+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTC
rJMSF028B08+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCT
rJMFF016O05+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTC
rJMFF005D13+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGC
rJMFF025L01+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCC
rJMFF003G17+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMSF011N18+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMSF010E09+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF005A12+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF030K07+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF007G05+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF033C07+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF049M02+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF050P13+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF051B17+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
rJMFF049A08+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTCCTTCCCTGTTATATAGTCTTCCGGGCTG
rJMFF037B24+ ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
                      ____________________________________________________________
consensus ATGTGCAATAGCCAATAGTGTTTAGTGTTGTACTTCACTGTTATATAGTCTTCCGGGCTG
 
. : . : . : . : . : . :
rJMFF003G17+ TATTCAAA
rJMSF011N18+ TA-TCAAAATAAATT
rJMSF010E09+ TATTCAAAAT
rJMFF005A12+ TATTCAAAATAAATT
rJMFF030K07+ TATTCAAAATAAATTTGTTAAGTTCAAT
rJMFF007G05+ TATTCAAAATAAATTTGTTAAGTTCAAT
rJMFF033C07+ TATTCAAAATAAATTTGTTAAGTTCAATTGGGAATCA
rJMFF049M02+ TATTCAAAATAAATTTGTTAAGTTCAATTGGGAATCATGATTTCAAGTT
rJMFF050P13+ TATTCAAAATAAATTTGTTAAGTTCAATTGGGAATCATGATTTCAAGTTTC
rJMFF051B17+ TATTCAAAATAAATTTGTTAAGTTCAATTGGGAATCATGATTTCAAGTTTC
rJMFF049A08+ TATTCAAAATAAATTTGTTAAGTTCAATTGGGAATCATGATTTCAAGTTTC
rJMFF037B24+ TATTCAAAATAAATTTGTTAAGTTCAATTGGGAATCATGATTTCAAGTTTCAACTTCCTG
                      ____________________________________________________________
consensus TATTCAAAATAAATTTGTTAAGTTCAATTGGGAATCATGATTTCAAGTTTCAACTTCCTG
 
. : . : . : . : . : . :
rJMFF037B24+ AACGTCTCTGTCATTCTTAGCTCACAGAAACTATATAATAAAAATATAAAATACAGAGCA
                      ____________________________________________________________
consensus AACGTCTCTGTCATTCTTAGCTCACAGAAACTATATAATAAAAATATAAAATACAGAGCA