Previous Contig 009932:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037A12Sequence530009932 (2)525009932 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF037A12+ TTTTTTTTTTAAATTAT
                      ____________________________________________________________
consensus TTTTTTTTTTAAATTAT
 
. : . : . : . : . : . :
JMFF037A12+ NGAAAAATCATCTCATATCTTGCTGTCTCTNTAAATTGTACAAAATTTATGTACGGTAAA
rJMFF037A12- TATCTTGCTGTCTCTCTAAATTGTACAAAATTTATGTACGGTAAA
                      ____________________________________________________________
consensus NGAAAAATCATCTCATATCTTGCTGTCTCTCTAAATTGTACAAAATTTATGTACGGTAAA
 
. : . : . : . : . : . :
JMFF037A12+ CTCAAACATGGTTGCTGGCTGCAAGAATTAAAAGTTGGAGAATTCAAACCGGAGATGTAG
rJMFF037A12- CTCAAACATGGTTGCTGGCTGCAAGAATTAAAAGTTGGAGAATTCAAACCGGAGATGTAG
                      ____________________________________________________________
consensus CTCAAACATGGTTGCTGGCTGCAAGAATTAAAAGTTGGAGAATTCAAACCGGAGATGTAG
 
. : . : . : . : . : . :
JMFF037A12+ TTTGATAGGTTTTTATAGTCAACCTTTTTGTTTTGGAGAGAATTTGACTAAGTTTGGTGT
rJMFF037A12- TTTGATAGGTTTTTATAGTCAACCTTTTTGTTTTGGAGAGAATTTGACTAAGTTTGGTGT
                      ____________________________________________________________
consensus TTTGATAGGTTTTTATAGTCAACCTTTTTGTTTTGGAGAGAATTTGACTAAGTTTGGTGT
 
. : . : . : . : . : . :
JMFF037A12+ TTTTCAAACATAGGGTTTCAAAAAAAAGGAAAGTTTGTTTGGCTTTTGAAAACATGCCAC
rJMFF037A12- TTTTCAAACATAGGGTTTCAAAAAAAAGGAAAGTTTGTTTGGCTTTTGAAAACATGCCAC
                      ____________________________________________________________
consensus TTTTCAAACATAGGGTTTCAAAAAAAAGGAAAGTTTGTTTGGCTTTTGAAAACATGCCAC
 
. : . : . : . : . : . :
JMFF037A12+ ATGAAACCCACAATACCACGCACAATCAACAAAGAATGTGCTGCCGCTTTAGCATCATCG
rJMFF037A12- ATGAAACCCACAATACCACGCACAATCAACAAAGAATGTGCTGCCGCTTTAGCATCATCG
                      ____________________________________________________________
consensus ATGAAACCCACAATACCACGCACAATCAACAAAGAATGTGCTGCCGCTTTAGCATCATCG
 
. : . : . : . : . : . :
JMFF037A12+ CCGGTGTCGCTGATGATTCCTCGATCTTCGGAGGCAAATTATATCATGTACCATGGTGCA
rJMFF037A12- CCGGTGTCGCTGATGATTCCTCGATCTTCGGAGGCAAATTATATCATGTACCATGGTGCA
                      ____________________________________________________________
consensus CCGGTGTCGCTGATGATTCCTCGATCTTCGGAGGCAAATTATATCATGTACCATGGTGCA
 
. : . : . : . : . : . :
JMFF037A12+ TGATAAATTATGCACCGCGCGTCCTTTTGTTAAATGAAAAGAAACGGTATTTGTTTTTCG
rJMFF037A12- TGATAAATTATGCACCGCGCGTCCTTTTGTTAAATGAAAAGAAACGGTATTTGTTTTTCG
                      ____________________________________________________________
consensus TGATAAATTATGCACCGCGCGTCCTTTTGTTAAATGAAAAGAAACGGTATTTGTTTTTCG
 
. : . : . : . : . : . :
JMFF037A12+ CCGTTTCGCACCCTCAGGCTCAAGACGACGGGCTGAGCGAGCGAGTGGACGTCCAGGAGC
rJMFF037A12- CCNTTTCGCACCCTCAGGCTCAAGACGACGGGCTGAGCGAGCGAGTGGACGTCCAGGAGC
                      ____________________________________________________________
consensus CCGTTTCGCACCCTCAGGCTCAAGACGACGGGCTGAGCGAGCGAGTGGACGTCCAGGAGC
 
. : . : . : . : . : . :
JMFF037A12+ AGCCGGCGAGGAGCAGTTTGCACGCTGTCTCGC
rJMFF037A12- AGCCGGCGAGGAGCAGTTTGCACGCTGTCTCGCTGAACGGAGGGCTGAAGCCACGATCCC
                      ____________________________________________________________
consensus AGCCGGCGAGGAGCAGTTTGCACGCTGTCTCGCTGAACGGAGGGCTGAAGCCACGATCCC