Previous Contig 009929:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036O15Sequence544009929 (2)pir|T07648|T076488e-06hypothetical protein T1P17.150 - Arabidopsis thaliana>gb:ATCHRIV34_1545021 Arabi723009929 (2)gb:AB092626_15250904e-16Prunus mume S7-SLFL2 gene for F-box, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036O15- ATTTTTCTCTGACCACAAACCCTCAGTCTCTCAGATCTTGAGAAGA
                      ____________________________________________________________
consensus ATTTTTCTCTGACCACAAACCCTCAGTCTCTCAGATCTTGAGAAGA
 
. : . : . : . : . : . :
JMFF036O15- TCAAAGAAGCAGATCAGAATGACTGCAGAAGAGACAAAGTTTGAGCATTTGCCGGAGGAT
                      ____________________________________________________________
consensus TCAAAGAAGCAGATCAGAATGACTGCAGAAGAGACAAAGTTTGAGCATTTGCCGGAGGAT
 
. : . : . : . : . : . :
JMFF036O15- GTGGTAGCGGAGATCTTATCAAGGCTGCCTGCCAAGTCCCTTCTGCAGTGCAAATCGCTG
                      ____________________________________________________________
consensus GTGGTAGCGGAGATCTTATCAAGGCTGCCTGCCAAGTCCCTTCTGCAGTGCAAATCGCTG
 
. : . : . : . : . : . :
JMFF036O15- CGCAAGAACTGGCGCCTCTCATTCAAACCCCAAATTTCGTCGCAAAGCACCACCACCATC
                      ____________________________________________________________
consensus CGCAAGAACTGGCGCCTCTCATTCAAACCCCAAATTTCGTCGCAAAGCACCACCACCATC
 
. : . : . : . : . : . :
JMFF036O15- CCACCAACCCCGCACTCTCCTTCGTTCACCATTACTCGCTCGACGCCATGGAATCTGGGT
                      ____________________________________________________________
consensus CCACCAACCCCGCACTCTCCTTCGTTCACCATTACTCGCTCGACGCCATGGAATCTGGGT
 
. : . : . : . : . : . :
JMFF036O15- TTTCATTGTTCGATGAAGAAACCCAAGTTCTCGCCTCCCATTCCTACCAAGATTACACCA
                      ____________________________________________________________
consensus TTTCATTGTTCGATGAAGAAACCCAAGTTCTCGCCTCCCATTCCTACCAAGATTACACCA
 
. : . : . : . : . : . :
JMFF036O15- ACACTTCGGTTTCCGTGTGGGAAATAAACGGCCCGCTAAACGGGCTGTTTTCTCTGTACA
                      ____________________________________________________________
consensus ACACTTCGGTTTCCGTGTGGGAAATAAACGGCCCGCTAAACGGGCTGTTTTCTCTGTACA
 
. : . : . : . : . : . :
JMFF036O15- ATGATCAAGAACAGGTGACTCTTTGGAACCCTGCTACTAGGGAGGCCAAGTCTCTCCCAG
rJMFF036O15+ CAG
                      ____________________________________________________________
consensus ATGATCAAGAACAGGTGACTCTTTGGAACCCTGCTACTAGGGAGGCCAAGTCTCTCCCAG
 
. : . : . : . : . : . :
JMFF036O15- TTTCATACCCAGAAGTTTCTGCCTCGTTTCGTATGAATTCGTATAAACTAGGATTTGGGA
rJMFF036O15+ TTTCATACCCAGAAGTTTCTGCCTCGTTTCGTATGAATTCGTATAAACTAGGATTTGGGA
                      ____________________________________________________________
consensus TTTCATACCCAGAAGTTTCTGCCTCGTTTCGTATGAATTCGTATAAACTAGGATTTGGGA
 
. : . : . : . : . : . :
JMFF036O15- TGGACCCATCAAACGGCA
rJMFF036O15+ TGGACCCATCAAACGGCAATTATAAAGTTGTTTGGATAAGAGACTATTGGGATCCAATCG
                      ____________________________________________________________
consensus TGGACCCATCAAACGGCAATTATAAAGTTGTTTGGATAAGAGACTATTGGGATCCAATCG
 
. : . : . : . : . : . :
rJMFF036O15+ CGGATGCTTGGCATTCACCTGCGATTATCTCAGTTTATACACTCACCACTGATTCCTGGA
                      ____________________________________________________________
consensus CGGATGCTTGGCATTCACCTGCGATTATCTCAGTTTATACACTCACCACTGATTCCTGGA
 
. : . : . : . : . : . :
rJMFF036O15+ AACACTTTGAAGAACTTCATATCTGCAGCCGCATACTGGGTAAATCTTGCTGTAACGCAT
                      ____________________________________________________________
consensus AACACTTTGAAGAACTTCATATCTGCAGCCGCATACTGGGTAAATCTTGCTGTAACGCAT
 
. : . : . : . : . : . :
rJMFF036O15+ ACTTGGATGGTTTTTACTACTGGAGAGCAAACAACAATGGGAAGGTCGTTTCATTCGACA
                      ____________________________________________________________
consensus ACTTGGATGGTTTTTACTACTGGAGAGCAAACAACAATGGGAAGGTCGTTTCATTCGACA
 
. : . : . : . : . : . :
rJMFF036O15+ TGGGAAATGAGGTTTTTCGGGAGATCCAAACACCAGAAACATTCAAATCCACGCAGGGAG
                      ____________________________________________________________
consensus TGGGAAATGAGGTTTTTCGGGAGATCCAAACACCAGAAACATTCAAATCCACGCAGGGAG
 
. : . : . : . : . : . :
rJMFF036O15+ ATTTGGCTTTGTACAATGATTCTGTTGCTATGTTTCTGTATGAATCGATGAATATGCAGA
                      ____________________________________________________________
consensus ATTTGGCTTTGTACAATGATTCTGTTGCTATGTTTCTGTATGAATCGATGAATATGCAGA
 
. : . : . : . : . : . :
rJMFF036O15+ CAAGCATTGATGTATGGGTTATGGATAGGGCAATGTGTTGGACCAAAATGGCGAGTCTTG
                      ____________________________________________________________
consensus CAAGCATTGATGTATGGGTTATGGATAGGGCAATGTGTTGGACCAAAATGGCGAGTCTTG
 
. : . : . : . : . : . :
rJMFF036O15+ GACCCTTTTTGAATATCAAGAGGCCGCTGGGATATGGGAAAAATGGTGAAGTTTTGTTAG
                      ____________________________________________________________
consensus GACCCTTTTTGAATATCAAGAGGCCGCTGGGATATGGGAAAAATGGTGAAGTTTTGTTAG
 
. : . : . : . : . : . :
rJMFF036O15+ AAATTGTGAATTCGGAACTGCACATGTATGATCCTAGGAGCAAAGAAATCAGGGCTCTTG
                      ____________________________________________________________
consensus AAATTGTGAATTCGGAACTGCACATGTATGATCCTAGGAGCAAAGAAATCAGGGCTCTTG
 
. : . : . : . : . : . :
rJMFF036O15+ GACCTAGGAGAAAAGGATATTCTCTGCAGGCTTCTGTATTCAAGGAGAGCTTAGTTTCAA
                      ____________________________________________________________
consensus GACCTAGGAGAAAAGGATATTCTCTGCAGGCTTCTGTATTCAAGGAGAGCTTAGTTTCAA
 
. : . : . : . : . : . :
rJMFF036O15+ TCAAGAATCTAGTTGCTCAAAAGTGAGAAGTGTAAGAATATAATTTTGCATATAATATAA
                      ____________________________________________________________
consensus TCAAGAATCTAGTTGCTCAAAAGTGAGAAGTGTAAGAATATAATTTTGCATATAATATAA