Previous Contig 009923:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036L18Sequence574001606 (2)pir|T49059|T490593e-08hypothetical protein T5P19.230 - Arabidopsis thaliana>gb:ATT5P19_1556263 Arabido629009923 (2)
JMSF009F20Sequence387001606 (2)gb:AY450930_16066943e-08Chlamydomonas reinhardtii plus agglutinin (SAG1) gene, complete cds; and unknown697009923 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009F20+ ACACTTACATAAGATTCATCAAGTCAAGCCTCCCGCTTGTCCTTT
                      ____________________________________________________________
consensus ACACTTACATAAGATTCATCAAGTCAAGCCTCCCGCTTGTCCTTT
 
. : . : . : . : . : . :
rJMSF009F20+ TGGCCCAAAGGGGAGGCCTCCGAGTAAAACACATAAACAAAATCATATGGCACCTCCNGT
rJMFF036L18+ CATAAACAAAATCATATGGCCCCTCCAGT
                      ____________________________________________________________
consensus TGGCCCAAAGGGGAGGCCTCCGAGTAAAACACATAAACAAAATCATATGGCCCCTCCAGT
 
. : . : . : . : . : . :
rJMSF009F20+ ATATGCACCAAATGCTGCTCCCGCTTCCTCATTGAAACCACATGGAGAGGCTCCAGCACC
rJMFF036L18+ ATATGCACCAAATGCTGCTCCCGCTTCCTCATTGAAACCACATGGAGAGGCTCCAGCACC
                      ____________________________________________________________
consensus ATATGCACCAAATGCTGCTCCCGCTTCCTCATTGAAACCACATGGAGAGGCTCCAGCACC
 
. : . : . : . : . : . :
rJMSF009F20+ TAGCCCACATGAAGTTCCTACACCGAGCCCNCTGCCAAATGTAGTTAATACCCGTGTTCA
rJMFF036L18+ TAGCCCNCATGAAGTTCCTACACCGAGCCCNCTGCCAAANGTAGTTAATACCCGTGTTCA
                      ____________________________________________________________
consensus TAGCCCACATGAAGTTCCTACACCGAGCCCNCTGCCAAATGTAGTTAATACCCGTGTTCA
 
. : . : . : . : . : . :
rJMSF009F20+ TCCCCCGTCAGGAAGTAATTNTGATGCAGAGCCTCCTGACAAATTGCGTTTAGTTTCGCA
rJMFF036L18+ TCCCCCGTCAGGAAGTAATTTTGATGCAGAGCCTCCTGACAAATTGCGTTTAGTTTCGCA
                      ____________________________________________________________
consensus TCCCCCGTCAGGAAGTAATTTTGATGCAGAGCCTCCTGACAAATTGCGTTTAGTTTCGCA
 
. : . : . : . : . : . :
rJMSF009F20+ CATCCCATCATCAGCATCCACAGTTCTTTATTCAAATTTATGGGCTCTTCCTCCATTTNT
rJMFF036L18+ CATCCCATCATCAGCATCCACAGTTTTTTATTCAAATTTATGGGCTNTTCCTCCATTTTT
                      ____________________________________________________________
consensus CATCCCATCATCAGCATCCACAGTTTTTTATTCAAATTTATGGGCTCTTCCTCCATTTTT
 
. : . : . : . : . : . :
rJMSF009F20+ ACTTGCNCTACATCTATAGCAGCGGAAAGAGAAGCAAAAAATTTTTTTTTTTCCAACAAA
rJMFF036L18+ ACTTGCACTACATNTATAGCAGCGGAAAGAGAAGCAAAAAATTTTTTTTTTTCCAACAAA
                      ____________________________________________________________
consensus ACTTGCACTACATCTATAGCAGCGGAAAGAGAAGCAAAAAATTTTTTTTTTTCCAACAAA
 
. : . : . : . : . : . :
rJMSF009F20+ TTCACCTCCTATATTCGGGGAAGGAGTTCAGTACAACACAATGGAGGAAATTTGAAGGCA
rJMFF036L18+ TTCACCTCCTATATTCGGGGAAGGAGTTCAGTACAACACAATGGAGGAAATTTGAAGGCA
                      ____________________________________________________________
consensus TTCACCTCCTATATTCGGGGAAGGAGTTCAGTACAACACAATGGAGGAAATTTGAAGGCA
 
. : . : . : . : . : . :
rJMSF009F20+ ATGTGAGAGCGATGATGCGGCATGCCCCTCAGCTCACTTTTGAGTAGATACCATATATAT
rJMFF036L18+ ATGTGAGAGCGATGATGCGGCATGCCCCTCAGCTCACTTTTGAGTAGATACCATATATAT
                      ____________________________________________________________
consensus ATGTGAGAGCGATGATGCGGCATGCCCCTCAGCTCACTTTTGAGTAGATACCATATATAT
 
. : . : . : . : . : . :
rJMSF009F20+ ATATATGTATTTTGTGCGTGTAAATATGTGATAAAACTTAAGGTGGTAGATGGATTTTCA
rJMFF036L18+ ATATATGTATTTTGTGCGTGTAAATATGTGATAAAACTTAAGGTGGTAGATGGATTTTCA
                      ____________________________________________________________
consensus ATATATGTATTTTGTGCGTGTAAATATGTGATAAAACTTAAGGTGGTAGATGGATTTTCA
 
. : . : . : . : . : . :
rJMSF009F20+ GGTCAAAGTCACAGAGGTGACGGGCCTGACATGACATGCATTGTTAATTGTTATGTATGA
rJMFF036L18+ GGTCAAAGTCACAGAGGTGACGGGCCTGACATGACATGCATTGTTAATTGTTATGTATGA
                      ____________________________________________________________
consensus GGTCAAAGTCACAGAGGTGACGGGCCTGACATGACATGCATTGTTAATTGTTATGTATGA
 
. : . : . : . : . : . :
rJMSF009F20+ TCTGTCTTCTACGTAAGATGTAAGGAGGGAATGAAATGAAACTAGCAAATGT
rJMFF036L18+ TCTGTCTTCTACGTAAGATGTAAGGAGGGAATGAAATGAAACTAGCAAATGTATAAAACT
                      ____________________________________________________________
consensus TCTGTCTTCTACGTAAGATGTAAGGAGGGAATGAAATGAAACTAGCAAATGTATAAAACT