Previous Contig 009920:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036K17Sequence522009920 (4)gb:AP005493_18528141e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN671009920 (4)gb:AP005493_18528148e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN044O08Sequence617009920 (4)gb:AP005493_18528146e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMSF018H02Sequence243019073gb:AF263100_17816580.001Populus tremula x Populus tremuloides putative AUX1-like permease (lax3) mRNA, c709009920 (4)gb:AP005493_18528148e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036K17- AGATTGATCTCAACAACAAACAAGC
                      ____________________________________________________________
consensus AGATTGATCTCAACAACAAACAAGC
 
. : . : . : . : . : . :
JMFF036K17- TCTTTAATGGCTTCATCAGCAACAACTAGAGCTTCCTTCACATTCTACCTCTCCCAGACC
rJMSF018H02+ TCCCAGACC
                      ____________________________________________________________
consensus TCTTTAATGGCTTCATCAGCAACAACTAGAGCTTCCTTCACATTCTACCTCTCCCAGACC
 
. : . : . : . : . : . :
JMFF036K17- CAACTCCCCACCCCTCCAAAACCCAAACCCCACCTCTCCTACCCCTATTCCCCTCTCCTC
rJMSF018H02+ CAACTCCCCACCCCTCCAAAACCCAAACCCCACCTCTCCTACCCCTATTCCCCTCTCCTC
rJMFF036K17+ TCCCCTCTCCTC
                      ____________________________________________________________
consensus CAACTCCCCACCCCTCCAAAACCCAAACCCCACCTCTCCTACCCCTATTCCCCTCTCCTC
 
. : . : . : . : . : . :
JMFF036K17- CCAAAACCCCTCTTCCTTTCCTCCATTTCCAGACACCCAAAGCCTCCAAGATCCATAGAT
rJMSF018H02+ CCAAAACCCCTCTTCCTTTCCTCCATTTCCAGACACCCAAAGCCTCCAAGATCCATAGAT
JMFN044O08- CCCTCTTCCTTTCCTCCATTTCCAGACACCCAAAGCCTCCAAGATCCATAGAT
rJMFF036K17+ CCAAAACCCCTCTTCCTTTCCTCCATTTCCAGACACCCAAAGCCTCCAAGATCCATAGAT
                      ____________________________________________________________
consensus CCAAAACCCCTCTTCCTTTCCTCCATTTCCAGACACCCAAAGCCTCCAAGATCCATAGAT
 
. : . : . : . : . : . :
JMFF036K17- GTCTCCCAAGAAGACAAGCCCATTTCCCAGCAACCAATTTCAGAACAGGCTGTTCAAGAA
rJMSF018H02+ GTCTCCCAAGAAGACAAGCCCATTTCCCAGCAACCAATTTCAGAACAGGCTGTTCAAGAA
JMFN044O08- GTCTCCCAAGAAGACAAGCCCATTTCCCAGCAACCAATTTCAGAACAGGCTGTTCAAGAA
rJMFF036K17+ GTCTCCCAAGAAGACAAGCCCATTTCCCAGCAACCAATTTCAGAACAGGCTGTTCAAGAA
                      ____________________________________________________________
consensus GTCTCCCAAGAAGACAAGCCCATTTCCCAGCAACCAATTTCAGAACAGGCTGTTCAAGAA
 
. : . : . : . : . : . :
JMFF036K17- CCAAGCTTTTCTCCAGAAACCTCTCAAGATTCACTCACAGAGGCTGAGAATTTCGATAAG
rJMSF018H02+ CCAAGCTTTTCTCCAGAAACCTCTCAAGATTCACTCACAGAGGCTGAGAATTTCGATAAG
JMFN044O08- CCAAGCTTTTCTCCAGAAACCTCTCAAGATTCACTCACAGAGGCTGAGAATTTCGATAAG
rJMFF036K17+ CCAAGCTTTTCTCCAGAAACCTCTCAAGATTCACTCACAGAGGCTGAGAATTTCGATAAG
                      ____________________________________________________________
consensus CCAAGCTTTTCTCCAGAAACCTCTCAAGATTCACTCACAGAGGCTGAGAATTTCGATAAG
 
. : . : . : . : . : . :
JMFF036K17- AGGAGATTGGAGGAGAAATTCGCTGTGCTAAACACTGGGATTTGTGAGTGCAGGTCCTGT
rJMSF018H02+ AGGAGATTGGAGGAGAAATTCGCTGTGCTAAACACTGGGATTTATGAGTGCAGGTCCTGT
JMFN044O08- AGGAGATTGGAGGAGAAATTCGCTGTGCTAAACACTGGGATTTATGAGTGCAGGTCCTGT
rJMFF036K17+ AGGAGATTGGAGGAGAAATTCGCTGTGCTAAACACTGGGATTTGTGAGTGCAGGTCCTGT
                      ____________________________________________________________
consensus AGGAGATTGGAGGAGAAATTCGCTGTGCTAAACACTGGGATTTGTGAGTGCAGGTCCTGT
 
. : . : . : . : . : . :
JMFF036K17- GGGTTCAAATATGATGAGGCAGCTGGTGACCCTTCATATCCCATTCCTCCTGGGTTGCCC
rJMSF018H02+ GGGTTCAAATATGATGAGGCAGCTGGTGACCCTTCATATCCCATTCCTCCTGGGTTGCCC
JMFN044O08- GGGTTCAAATATGATGAGGCAGCTGGTGACCCTTCATATCCCATTCCTCCTGGGTTGCCC
rJMFF036K17+ GGGTTCAAATATGATGAGGCAGCTGGTGACCCTTCATATCCCATTCCTCCTGGGTTGCCC
                      ____________________________________________________________
consensus GGGTTCAAATATGATGAGGCAGCTGGTGACCCTTCATATCCCATTCCTCCTGGGTTGCCC
 
. : . : . : . : . : . :
JMFF036K17- TTTGATAGGATGCCTGAGGATTGGAGGTGCCCTACTTGTGGGGCGGCCAAGAGTTTCTTC
rJMSF018H02+ TTTGATAGGATGCCTGAGGATTGGAGGTGCCCTACTTGTGGGGCGGCCAAGAGTTTCTTC
JMFN044O08- TTTGATAGGATGCCTGAGGATTGGAGGTGCCCTACTTGTGGGGCGGCCAAGAGTTTCTTC
rJMFF036K17+ TTTGATAGGATGCCTGAGGATTGGAGGTGCCCTACTTGTGGGGCGGCCAAGAGTTTCTTC
                      ____________________________________________________________
consensus TTTGATAGGATGCCTGAGGATTGGAGGTGCCCTACTTGTGGGGCGGCCAAGAGTTTCTTC
 
. : . : . : . : . : . :
JMFF036K17- CAGAGCAAGAGCGTGGA
rJMSF018H02+ CAGAGCAAGAGCGTGGAGATTGCCGGTTTTGCCCAGAATCAGCAATTTGGATTGGGTGGT
JMFN044O08- CAGAGCAAGAGCGTGGAGATTGCCGGTTTTGCCCAGAATCAGCAATTTGGATTGGGTGGT
rJMFF036K17+ CAGAGCAAGAGCGTGGAGATTGCCGGTTTTGCCCAGAATCAGCAATTTGGATTGGGTGGT
                      ____________________________________________________________
consensus CAGAGCAAGAGCGTGGAGATTGCCGGTTTTGCCCAGAATCAGCAATTTGGATTGGGTGGT
 
. : . : . : . : . : . :
rJMSF018H02+ AATACTCTCACCTCTGGCCAGAAGGCTCTCCTTATCTATGGTGGTTTGTTCTTGGGATTC
JMFN044O08- AATACTCTCACCTCTGGCCAGAAGGCTCTCCTTATCTATGGTGGTTTGTTCTTGGGATTC
rJMFF036K17+ AATACTCTCACCTCTGGCCAGAAGGCTCTCCTTATCTATGGTGGTTTGTTCTTGGGATTC
                      ____________________________________________________________
consensus AATACTCTCACCTCTGGCCAGAAGGCTCTCCTTATCTATGGTGGTTTGTTCTTGGGATTC
 
. : . : . : . : . : . :
rJMSF018H02+ GTGTTCTTCTTGTCTGGTTACTTTCTGCAATAGCTGAGGACTTTATGTTTTGCTCAATTT
JMFN044O08- GTGTTCTTCTTGTCTGGTTACTTTCTGCAATAGCTGAGGACTTTATGTTTTGCTCAATTT
rJMFF036K17+ GTGTTCTTCTTGTCTGGTTACTTTCTGCAATAGCTGAGGACTTTATGTTTTGCTCAATTT
                      ____________________________________________________________
consensus GTGTTCTTCTTGTCTGGTTACTTTCTGCAATAGCTGAGGACTTTATGTTTTGCTCAATTT
 
. : . : . : . : . : . :
rJMSF018H02+ GATGGTTCTCAGTTAGTATAGATTTTTGCACTTGTGTTGTTATGTGATGATAATAATAAT
JMFN044O08- GATGATTCTCAGTTAGTATAGATTTTTGCACTTGTGTTGTTATGTGATGATAATAATAAT
rJMFF036K17+ GATGATTCTCAGTTAGTATAGATTTTTGCACTTGTGTTGTTATGTGATGATAATAATAAT
                      ____________________________________________________________
consensus GATGATTCTCAGTTAGTATAGATTTTTGCACTTGTGTTGTTATGTGATGATAATAATAAT
 
. : . : . : . : . : . :
rJMSF018H02+ AATAGTGTATGGTTTGGTATACCAGAGATGTAAGTAAGAT
JMFN044O08- AATAGTGTATGGTTTGGTATA-C
rJMFF036K17+ AATAGTGTATGGTTTGGTATA-CAGAGATGTAAGTAAGATTCAAATATATGCAAAAACCA
                      ____________________________________________________________
consensus AATAGTGTATGGTTTGGTATA-CAGAGATGTAAGTAAGATTCAAATATATGCAAAAACCA