Previous Contig 009919:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036J13Sequence154009919 (3)gb:ATAHP1_15438597e-07Arabidopsis thaliana mRNA for AT-hook protein 1.683009919 (3)gb:AP004765_18446682e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P071
JMSF048N10Sequence325020453gb:BT005545_16384850.006Arabidopsis thaliana clone U51005 putative DNA-binding protein (At1g63470) mRNA,760009919 (3)gb:AP004765_18446681e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P071

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048N10+ GGAGAGGATGTGCAGGCAAAATTAATGTCGTTTTCTCAGAATACCTCG
                      ____________________________________________________________
consensus GGAGAGGATGTGCAGGCAAAATTAATGTCGTTTTCTCAGAATACCTCG
 
. : . : . : . : . : . :
JMFF036J13- TCTGTATTCTGTCAGCAAACGGTGCCATATCTAATGTAACACTTCGCCAAGCA
rJMSF048N10+ CAAGCCATCTGTATTCTGTCAGCAAACGGTGCCATATCTAATGTAACACTTCGCCAAGCA
                      ____________________________________________________________
consensus CAAGCCATCTGTATTCTGTCAGCAAACGGTGCCATATCTAATGTAACACTTCGCCAAGCA
 
. : . : . : . : . : . :
JMFF036J13- GCAACGTCTGGTGGGACTGTGACCTATGAG
rJMSF048N10+ GCAACGTCTGGTGGGACTGTGACCTATGAGGGACGATTCGAGATCCTGTCTCTATCGGGA
rJMFF036J13+ AGGGACGATTCGAGATCCTGTCTCTATCGGGA
                      ____________________________________________________________
consensus GCAACGTCTGGTGGGACTGTGACCTATGAGGGACGATTCGAGATCCTGTCTCTATCGGGA
 
. : . : . : . : . : . :
rJMSF048N10+ TCCTTTCTACTCTCGGAACTGGGTGGTCAGCGCAGCAGAACGGGTGGTTTGAGCGTGTCC
rJMFF036J13+ TCCTTTNTACTCTCGGAACTGGGTGGTCAGCGCAGCAGAACGGGTGGTTTGAGCGTGTCC
                      ____________________________________________________________
consensus TCCTTTCTACTCTCGGAACTGGGTGGTCAGCGCAGCAGAACGGGTGGTTTGAGCGTGTCC
 
. : . : . : . : . : . :
rJMSF048N10+ CTAGCCGGACCAGATGGTCACGTTTTAGGCGGTTGCGTTGCAGGTCTTCTAACCGCTGCA
rJMFF036J13+ CTAGCCGGACCAGATGGTCACGTTTTAGGCGGTTGCGTTGCAAGTCTTCTAACCGCTGCA
                      ____________________________________________________________
consensus CTAGCCGGACCAGATGGTCACGTTTTAGGCGGTTGCGTTGCAGGTCTTCTAACCGCTGCA
 
. : . : . : . : . : . :
rJMSF048N10+ TCTCCCGTTCAGGTTATTGTTGGAAGTTTCAGCATTGAAGTTCATCAACAGCAAGCAGGC
rJMFF036J13+ TCTCCCGTTCAGGTTATTGTTGGAAGTTTCAGCATTGAAGTTCATCAACAGCAAGCAGGC
                      ____________________________________________________________
consensus TCTCCCGTTCAGGTTATTGTTGGAAGTTTCAGCATTGAAGTTCATCAACAGCAAGCAGGC
 
. : . : . : . : . : . :
rJMSF048N10+ AATTGTGAAGGGCTAGCCAGTCCAGGCATGCTCATTTCAGGAGGAGCCGCCAAAAGCCCA
rJMFF036J13+ AATTGTGAAGGGCTAGCCAGTCCAGGCATGCTCATTTCAGGAGGAGCCGCCAAAAGCCCA
                      ____________________________________________________________
consensus AATTGTGAAGGGCTAGCCAGTCCAGGCATGCTCATTTCAGGAGGAGCCGCCAAAAGCCCA
 
. : . : . : . : . : . :
rJMSF048N10+ CCTTCGCTTGGAACCCTAAGCGCGTCCAGTGGTGGCGGCCCCGTCAGCCCTCATAACCAC
rJMFF036J13+ CCTTCGCTCGGAACCCTAAGCGCATCCAGTGGTGGCGGCCCCGTCAGCCCTCATAACCAC
                      ____________________________________________________________
consensus CCTTCGCTTGGAACCCTAAGCGCGTCCAGTGGTGGCGGCCCCGTCAGCCCTCATAACCAC
 
. : . : . : . : . : . :
rJMSF048N10+ CACCTCGAAACTTCAAATAGCAGTCCGTCTGGAATCGCGAGCATCCAGTGGAGGTAGAAC
rJMFF036J13+ CACCTCGAAACTTCAAATAGCAGTCCGTCTGGAATCGCGAGCATCCAGTGGAGGTAGAAC
                      ____________________________________________________________
consensus CACCTCGAAACTTCAAATAGCAGTCCGTCTGGAATCGCGAGCATCCAGTGGAGGTAGAAC
 
. : . : . : . : . : . :
rJMSF048N10+ AACTCAAAATGTAACTGGGGATCGCCCCCCGGNCCCGCCCTCCACCCCACCCCCTCCTAA
rJMFF036J13+ AACTCAAAATGTAACTCGGGATCGCCCCCCGGCCCCGCCCTCCACCCCACCCCCTCCTAA
                      ____________________________________________________________
consensus AACTCAAAATGTAACTGGGGATCGCCCCCCGGCCCCGCCCTCCACCCCACCCCCTCCTAA
 
. : . : . : . : . : . :
rJMSF048N10+ CTCTGTTCTAGGAAAACCTNTCATCNTAATTCTCTAGGAACCTTAGCAATCTAGTTTATT
rJMFF036J13+ CTCTGTTCTAGGAAAACCTGTCATCATAATTCTCTAGGAACCTTAGCAATCTAGTTTATT
                      ____________________________________________________________
consensus CTCTGTTCTAGGAAAACCTGTCATCATAATTCTCTAGGAACCTTAGCAATCTAGTTTATT
 
. : . : . : . : . : . :
rJMSF048N10+ ATGTAGTATGTAGGACTCAGCTTNNTGTGTGTGTGTAATGAATGTGTGCAATTTAGGTTA
rJMFF036J13+ ATGTAGTATGTAGGACTCAGCTTTGTGTGTGTGTGTAATGAA-GTGTGCAATTTAGGTTA
                      ____________________________________________________________
consensus ATGTAGTATGTAGGACTCAGCTTTGTGTGTGTGTGTAATGAATGTGTGCAATTTAGGTTA
 
. : . : . : . : . : . :
rJMSF048N10+ AGTGACACCTTACAACCTGTCCTGTGTGATNTGCATTTNACAATGTCAAACC
rJMFF036J13+ AGTGACACCTTACAA-CTG-CCTGTGTGATTTGCATTTTACAATGTCAAACCACTTATAT
                      ____________________________________________________________
consensus AGTGACACCTTACAACCTGTCCTGTGTGATTTGCATTTTACAATGTCAAACCACTTATAT