Previous Contig 009913:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036I11Sequence535001595 (2)gb:AP003842_18340881e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16745009913 (3)gb:AP005869_18593342e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B102
JMSF037L17Sequence659009913 (3)gb:AP005869_18593342e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B102
JMSF037M17Sequence617009913 (3)gb:AY088598_15736141e-23Arabidopsis thaliana clone 8256 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037L17+ TGTTCAAAGCCCA
                      ____________________________________________________________
consensus TGTTCAAAGCCCA
 
. : . : . : . : . : . :
rJMSF037L17+ GTTCTTTGGCCTCATTGGAAATCCTAATACAGATAAAGTAGAACTTGAGGATATTGAACC
rJMSF037M17+ ACAGATAAAGTAGANCTTGAGGATATTGAACC
                      ____________________________________________________________
consensus GTTCTTTGGCCTCATTGGAAATCCTAATACAGATAAAGTAGAACTTGAGGATATTGAACC
 
. : . : . : . : . : . :
rJMSF037L17+ ATCAATATTTAAGGCTATGCTTCAATTTCTTTACACCGATCAGCTT-CCAAATTTACATG
rJMSF037M17+ ATCAATANTTAAGNCTATGCTTCAATTTCTTTACACCGATCAGCTT-CCAAATTTACANG
rJMFF036I11+ CCGATCAGCTTCCCAAATTTACATG
                      ____________________________________________________________
consensus ATCAATATTTAAGGCTATGCTTCAATTTCTTTACACCGATCAGCTT-CCAAATTTACATG
 
. : . : . : . : . : . :
rJMSF037L17+ AAATTATTGGCTCAACCTCAACGTGCACTTCAACAATCATGATGCAACATTTATTGGCTG
rJMSF037M17+ AAATTATTGGCTCAACCTCAACGTGCACTTCAACAATCATGATGCAACATTTATTGGCTG
rJMFF036I11+ AAATTATTGGCTCACCNTCAACGTGCACTTCAACAATCATGATGCAACATTTATTGGCTG
                      ____________________________________________________________
consensus AAATTATTGGCTCAACCTCAACGTGCACTTCAACAATCATGATGCAACATTTATTGGCTG
 
. : . : . : . : . : . :
rJMSF037L17+ CAGCTGACCGGTTTGGTTTAGATAGACTGAAACAATTATGTGAGGCAAAATTGTGTGAAG
rJMSF037M17+ CAGCTGACCGGTTTGGTNTAGATAGACTGAAACAATTATGNGAGGCAAAATTGTGTGAAG
rJMFF036I11+ CAGCTGACCGGTTTGGTTTAGATAGACTGAAACAATTATGTGAGGCAAAATTGTGTGAAG
                      ____________________________________________________________
consensus CAGCTGACCGGTTTGGTTTAGATAGACTGAAACAATTATGTGAGGCAAAATTGTGTGAAG
 
. : . : . : . : . : . :
rJMSF037L17+ AAGTAACTGTCGATACGGTGGCAACGACTCTTTCACTAGCTGATCAACATCGATGCCTCC
rJMSF037M17+ AAGTAACTGTCGATACGGTGGCAACGACTCTTTCACTAGCTGATCAACATCGATNCCTCC
rJMFF036I11+ AAGTAACTGTCGATACGGTGGCAACGACTCTTTCACTAGCTGATCAACATCGATGCCTCC
                      ____________________________________________________________
consensus AAGTAACTGTCGATACGGTGGCAACGACTCTTTCACTAGCTGATCAACATCGATGCCTCC
 
. : . : . : . : . : . :
rJMSF037L17+ AGCTTAAGACCATATGTTTGAAATTTGCAGCTACAAACTTGGG-----------AGTCTG
rJMSF037M17+ AGCTTAAGACCATATGTTTGAAATTTGCANCTACAAACNTGGG-----------AGTCTG
rJMFF036I11+ AGCTTAAGACCATATGTTTGAAATTTGCAGCTACAAACTTGGGAGTTGTTATGCAGTCTG
                      ____________________________________________________________
consensus AGCTTAAGACCATATGTTTGAAATTTGCAGCTACAAACTTGGG-----------AGTCTG
 
. : . : . : . : . : . :
rJMSF037L17+ AAGGGTTCAAGCACTTGGAAGAGAGCTGCCCCTCACTGTTGTCTGAGCTGTTGGAAACAG
rJMSF037M17+ AAGGGTTCAAGCACTTGGAAGAGAGCTGCCCCTCACTGTTGTNTGAGCTGTTGGAAACAG
rJMFF036I11+ AAGGGTTCAAGCACTTGGAAGAGAGCTGCCCCTCACTGTTGTCTGAGCTGTTGGAAACAG
                      ____________________________________________________________
consensus AAGGGTTCAAGCACTTGGAAGAGAGCTGCCCCTCACTGTTGTCTGAGCTGTTGGAAACAG
 
. : . : . : . : . : . :
rJMSF037L17+ TTGCATCAATCGACGAAAAGG
rJMSF037M17+ TTGCATCAATCGACGAAAAGG
rJMFF036I11+ TTGCATCAATCGACGAAAAGGCAAGTCTAATCTCTAGCAGGAAGAGGAGTAGCAGCAGCA
                      ____________________________________________________________
consensus TTGCATCAATCGACGAAAAGGCAAGTCTAATCTCTAGCAGGAAGAGGAGTAGCAGCAGCA
 
. : . : . : . : . : . :
rJMFF036I11+ TCTTTGGGGTAGACTTAGTACCCGATGGTGCTGCAGCAGAACCATTTAATCCTAATATGA
                      ____________________________________________________________
consensus TCTTTGGGGTAGACTTAGTACCCGATGGTGCTGCAGCAGAACCATTTAATCCTAATATGA
 
. : . : . : . : . : . :
rJMFF036I11+ GGTGTTTGCGGAGGCGGATGTAATCTTGTAATTGCAATGAACGCTGGCTGGCTGGCTGGC
                      ____________________________________________________________
consensus GGTGTTTGCGGAGGCGGATGTAATCTTGTAATTGCAATGAACGCTGGCTGGCTGGCTGGC
 
. : . : . : . : . : . :
rJMFF036I11+ TGGCTGGCTGGCTGGCTGGCTGGCCTTGTGATGAGCTATCTATTTGAAAACTACTGCACT
                      ____________________________________________________________
consensus TGGCTGGCTGGCTGGCTGGCTGGCCTTGTGATGAGCTATCTATTTGAAAACTACTGCACT
 
. : . : . : . : . : . :
rJMFF036I11+ AATGGTTTTGTCCATATATTATATATTAGTTTAAACTTATGTAGAAACATTTCTTGTGAT
                      ____________________________________________________________
consensus AATGGTTTTGTCCATATATTATATATTAGTTTAAACTTATGTAGAAACATTTCTTGTGAT
 
. : . : . : . : . : . :
rJMFF036I11+ TTTATGTTGTGTGAGGTTAGGCGTATGGACTGTGAATTGTTTTTGCATCCATGTTTTAGA
                      ____________________________________________________________
consensus TTTATGTTGTGTGAGGTTAGGCGTATGGACTGTGAATTGTTTTTGCATCCATGTTTTAGA
 
. : . : . : . : . : . :
rJMFF036I11+ CACTCTTAAGTGGGGTTAGATGAGAAGTAATGGTTTTAGACATTCTGTGTTCTACTAATC
                      ____________________________________________________________
consensus CACTCTTAAGTGGGGTTAGATGAGAAGTAATGGTTTTAGACATTCTGTGTTCTACTAATC