Previous Contig 009912:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015H01Sequence598001594 (2)gb:AB024034_15158177e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC11.>gb:AY087770_157680009912 (2)gb:AB024034_15158179e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC11.>gb:AY087770_157
JMFF036I06Sequence571001594 (2)gb:AB024034_15158179e-30Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC11.>gb:AY087770_157712009912 (2)gb:AB024034_15158172e-33Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC11.>gb:AY087770_157

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015H01+ TGATTATGGTTATGTAATATCTG
rJMFF036I06+ TCAGTTGTTGGCACAATTGATGCGAAGTTTGATTATGGTTATGTAATATCTG
                      ____________________________________________________________
consensus TCAGTTGTTGGCACAATTGATGCGAAGTTTGATTATGGTTATGTAATATCTG
 
. : . : . : . : . : . :
rJMFF015H01+ TGAACATGGGTCCCGAGATTTTCAATGGCGCTCTTTATCATAAACCTATGCAACTAGATT
rJMFF036I06+ TGAACATGGGTCCCGAGATTTTCAATGGCGCTCTTTATCATAAACCTATGCAACTAGATT
                      ____________________________________________________________
consensus TGAACATGGGTCCCGAGATTTTCAATGGCGCTCTTTATCATAAACCTATGCAACTAGATT
 
. : . : . : . : . : . :
rJMFF015H01+ CATCTCAGAGTGCTAGTGCTTCAACTGGACCTGCTAAACTGAATAGAAAGAAACACCAGC
rJMFF036I06+ CATCTCAGAGTGCTAGTGCTTCAACTGGACCTGCTAAACTGAATAGAAAGAAACACCAGC
                      ____________________________________________________________
consensus CATCTCAGAGTGCTAGTGCTTCAACTGGACCTGCTAAACTGAATAGAAAGAAACACCAGC
 
. : . : . : . : . : . :
rJMFF015H01+ TTGCACTAACGGATCCCTCTAAACCGAGGCAAAACCTAAGTGGCTACAATTTCTTTTTCG
rJMFF036I06+ TTGCACTAACGGATCCCTCTAAACCGATGCAAAACCTAAGTGGCTACAATTTCTTTTTCG
                      ____________________________________________________________
consensus TTGCACTAACGGATCCCTCTAAACCGATGCAAAACCTAAGTGGCTACAATTTCTTTTTCG
 
. : . : . : . : . : . :
rJMFF015H01+ CTGAACACTATGCCAGGCTGAAGCCTGCACATCACGGCCACGTGAGAGCTATCAGCAAGG
rJMFF036I06+ CTGAACACTATGCCAGGCTGAAGCCTGCACATCACGGCCACGTGAGAGCTATCAGCAAGG
                      ____________________________________________________________
consensus CTGAACACTATGCCAGGCTGAAGCCTGCACATCACGGCCACGTGAGAGCTATCAGCAAGG
 
. : . : . : . : . : . :
rJMFF015H01+ AAATTGGAATGCTATGGAGCAGACTCTCAGACGCCGAGAAACAGGTTTATCAGGAAAAGG
rJMFF036I06+ AAATTGGAATGCTATGGAGCAGACTCTCAGACGCCGAGAAACAGGTTTATCAGGAAAAGG
                      ____________________________________________________________
consensus AAATTGGAATGCTATGGAGCAGACTCTCAGACGCCGAGAAACAGGTTTATCAGGAAAAGG
 
. : . : . : . : . : . :
rJMFF015H01+ GCTTGAGAGATAAGGAGAGATACAGGACCGAGATGCTCGAGTATAAGTCCTCTCAGCCCT
rJMFF036I06+ GCTTGAGAGATAAGGAGAGATACAGGACCGAGATGCTCGAGTATAAGTCCTCTCAGCCCT
                      ____________________________________________________________
consensus GCTTGAGAGATAAGGAGAGATACAGGACCGAGATGCTCGAGTATAAGTCCTCTCAGCCCT
 
. : . : . : . : . : . :
rJMFF015H01+ TACAAATTCAATAGATATAATTTGGGAAATTGTTTCCCATGGGATCACTACTTCCTACAA
rJMFF036I06+ TACAAATTCAATAGATATAATTTGGGAAATTGTTTCCCATGGGATCACTACTTCCTACAA
                      ____________________________________________________________
consensus TACAAATTCAATAGATATAATTTGGGAAATTGTTTCCCATGGGATCACTACTTCCTACAA
 
. : . : . : . : . : . :
rJMFF015H01+ CGGTTTTGGGAAATTGTTTTTGTCAATTGGCCTAGTTTAGATCTTTCCCTTGCAACCTTT
rJMFF036I06+ CGGTTTTGGGAAATTGTTTTTGTCAATTGGCCTAGTTTAGATCTTTCCCTTGCAACCTTT
                      ____________________________________________________________
consensus CGGTTTTGGGAAATTGTTTTTGTCAATTGGCCTAGTTTAGATCTTTCCCTTGCAACCTTT
 
. : . : . : . : . : . :
rJMFF015H01+ TCACCTAATATTCGGTTTGGTGGAAATGAAATCCTCAGGCCTTAATTAGTGCACAGTTTG
rJMFF036I06+ TCACCTAATATTCGGTTTGGTGGAAATGAAATCCTCAGGCCTTAATTAGTGCACAGTTTG
                      ____________________________________________________________
consensus TCACCTAATATTCGGTTTGGTGGAAATGAAATCCTCAGGCCTTAATTAGTGCACAGTTTG
 
. : . : . : . : . : . :
rJMFF015H01+ GAACATAGGAAATGGGCTTTTCTTTCCTTTAGTATTAGTTTTGGAGTGGACAAACTTCAT
rJMFF036I06+ GAACATAGGAAATGGGCTTTTCTTTCCTTTAGTATTAGTTTTGGAGTGGACAAACTTCAT
                      ____________________________________________________________
consensus GAACATAGGAAATGGGCTTTTCTTTCCTTTAGTATTAGTTTTGGAGTGGACAAACTTCAT
 
. : . : . : . : . : . :
rJMFF015H01+ AGTCAAGTCATGTTCATCTAGTTTGACAATTGAACATGAATGTAAATTAAAA
rJMFF036I06+ AGTCAAGTCATGTTCATCTAGTTTGACAATTGAACATGAATGTAAATTAAAATNAAGANA
                      ____________________________________________________________
consensus AGTCAAGTCATGTTCATCTAGTTTGACAATTGAACATGAATGTAAATTAAAATNAAGANA