Previous Contig 009908:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004K03Sequence537000213 (4)gb:ATAC010676_15431348e-29Arabidopsis thaliana chromosome III BAC T22N4 genomic sequence, complete sequenc706009908 (3)pir|T51439|T514391e-69oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442
JMFF017C24Sequence546000213 (4)pir|T51439|T514392e-50oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442 748009908 (3)pir|T51439|T514391e-68oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442
JMFF036H07Sequence551000213 (4)pir|T51439|T514391e-51oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442 699009908 (3)pir|T51439|T514398e-59oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF004K03+ CACCAAACAAGGCATGACGATGAAGAGAA
rJMFF017C24+ CACCAAACAAGGCATGACGATGAAGAGAA
                      ____________________________________________________________
consensus CACCAAACAAGGCATGACGATGAAGAGAA
 
. : . : . : . : . : . :
rJMFF004K03+ ACATCGGACCCAATTTCAAGATCCCACCCGCCGCGCTTCAGAGCGCGATCACAGTGTCCA
rJMFF017C24+ GCATCGGACCCAATTTCAAGATCCCACCCGCCGCGCTTCAGAGCGCGATCACAGTGTCCA
rJMFF036H07+ TCCCACCCGCCGCGCTTCAGAGCGCGATCACAGTGTCCA
                      ____________________________________________________________
consensus GCATCGGACCCAATTTCAAGATCCCACCCGCCGCGCTTCAGAGCGCGATCACAGTGTCCA
 
. : . : . : . : . : . :
rJMFF004K03+ TAATTCTTCTCATGCCTCTGTACGACAAGTACTTCATCCCCCTCGTTCGCGTCTTCACCC
rJMFF017C24+ TAATTCTTCTCATGCCTCTGTACGACAAGTACTTCATCCCCCTCGTTCGCGTCTTCACCC
rJMFF036H07+ TAATTCTTCTCATGCCTCTGTACGACAAGTACTTCATCCCCCTCGTTCGCGTCTTCACCC
                      ____________________________________________________________
consensus TAATTCTTCTCATGCCTCTGTACGACAAGTACTTCATCCCCCTCGTTCGCGTCTTCACCC
 
. : . : . : . : . : . :
rJMFF004K03+ TCAACGACAAAGGCGTCACCGTGCGGCAAAGAATGGGGATCGGAATGTTTCTGTCGGTGA
rJMFF017C24+ TCAACGACAAAGGCGTCACCGTGCGGCAAAGAATGGGGATCGGAATGTTTCTGTCGGTGA
rJMFF036H07+ TCAACGACAAAGGCGTCACCGTGCGGCAAAGAATGGGGATCGGAATGTTTCTGTCGGTGA
                      ____________________________________________________________
consensus TCAACGACAAAGGCGTCACCGTGCGGCAAAGAATGGGGATCGGAATGTTTCTGTCGGTGA
 
. : . : . : . : . : . :
rJMFF004K03+ TAGCCATGGTGATTGCCGCCTTCACGGACACAAAGAGGCTCGAAATCAGCAGAAATCCCG
rJMFF017C24+ TAGCCATGGTGATTGCCGCCTTCACGGACACAAAGAGGCTCGAAATCAGCAGAAATCCCG
rJMFF036H07+ TAGCCATGGTGATTGCCGCCTTCACGGACACAAAGAGGCTCGAAATCAGCAGAAATCCCG
                      ____________________________________________________________
consensus TAGCCATGGTGATTGCCGCCTTCACGGACACAAAGAGGCTCGAAATCAGCAGAAATCCCG
 
. : . : . : . : . : . :
rJMFF004K03+ AGAATCTAAGCTCAGAAACAGTGCCGATGAGCATATTCTGGCTGCTTCCGCAGTACATCC
rJMFF017C24+ AGAATCTAAGCTCAGAAACAGTGCCGATGAGCATATTCTGGCTGCTTCCGCAGTACATCC
rJMFF036H07+ AGAATCTAAGCTCAGAAACAGTGCCGATGAGCATATTCTGGCTGCTTCCGCAGTACATCC
                      ____________________________________________________________
consensus AGAATCTAAGCTCAGAAACAGTGCCGATGAGCATATTCTGGCTGCTTCCGCAGTACATCC
 
. : . : . : . : . : . :
rJMFF004K03+ TCCTCGGAATCTCCGACATCTTCACCGTGGTCGGGATGCAAGAGTTTTTCTACTCCGAAG
rJMFF017C24+ TCCTCGGAATCTCCGACATCTTCACCGTGGTCGGGATGCAAGAGTTTTTCTACTCCGAAG
rJMFF036H07+ TCCTCGGAATCTCCGACATCTTCACCGTGGTCGGGATGCAAGAGTTTTTCTACTCCGAAG
                      ____________________________________________________________
consensus TCCTCGGAATCTCCGACATCTTCACCGTGGTCGGGATGCAAGAGTTTTTCTACTCCGAAG
 
. : . : . : . : . : . :
rJMFF004K03+ TCCCGGCGAACATGAGAACCTTAGGGATAGCTCTGTACACTAGCGTCTTCGGTTTCGGAA
rJMFF017C24+ TCCCGGCGAACATGAGAACCTTAGGGATAGCTCTGTACACTAGCGTCTTCGGTTTCGGAA
rJMFF036H07+ TCCCGGCGAACATGAGAACCTTAGGGATAGCTCTGTACACTAGCGTCTTCGGTTTCGGAA
                      ____________________________________________________________
consensus TCCCGGCGAACATGAGAACCTTAGGGATAGCTCTGTACACTAGCGTCTTCGGTTTCGGAA
 
. : . : . : . : . : . :
rJMFF004K03+ GCTTCTTCAGCTCCCTGCTTATCTCCATTGTAGAACATTTCACAAGCTCCTCTGCAAATC
rJMFF017C24+ GCTTCTTCAGCTCCCTGCTTATCTCCATTGTAGAACATTTCACAAGCTCCTCTGCAAATC
rJMFF036H07+ GCTTCTTCAGCTCCCTGCTTATCTCCATTGTAGAACATTTCACAAGCTCCTCTGCAAATC
                      ____________________________________________________________
consensus GCTTCTTCAGCTCCCTGCTTATCTCCATTGTAGAACATTTCACAAGCTCCTCTGCAAATC
 
. : . : . : . : . : . :
rJMFF004K03+ AGCATGGGTGGTTCTCTGATGATATGAAGGAAGCCCGTTTAGATAATTATTATTGGTTTC
rJMFF017C24+ AGCATGGGTGGTTCTCTGATGATATGAAGGAAGCCCGTTTAGATAATTATTATTGGTTTC
rJMFF036H07+ AGCATGGGTGGTTCTCTGATGATATGAAGGAAGCCCGTTTAGATAATTATTATTGGTTTC
                      ____________________________________________________________
consensus AGCATGGGTGGTTCTCTGATGATATGAAGGAAGCCCGTTTAGATAATTATTATTGGTTTC
 
. : . : . : . : . : . :
rJMFF004K03+ TCGCCGTGTTAAGTGCTGTCAGCTTGATCTTATTCGTAATCTTCTGTAAGTTTAATGGTT
rJMFF017C24+ TCGCCGTGTTAAGTGCTGTCAGCTTGACCTTATTCGTAATCTTCTGTAAGTTTAATGGTT
rJMFF036H07+ TCGCCGTGTTAAGTGCTGTCAGCTTGACCTTATTCGTAATCTTCTGTAAGTTTAATGGTT
                      ____________________________________________________________
consensus TCGCCGTGTTAAGTGCTGTCAGCTTGACCTTATTCGTAATCTTCTGTAAGTTTAATGGTT
 
. : . : . : . : . : . :
rJMFF004K03+ CTTGAAAGTTAATTTCAATCTGGATTTTATTATGCTCTACCAGTTTGGAATGGACTGTCA
rJMFF017C24+ CTTGAAAGTTAATTTCAATCTGGATTTTATTATGCTCTACCAGTTTGGAATGGACTGTCA
rJMFF036H07+ CTTGAAAGTTAATTTCAATCTGGATTTTATTATGCTCTACCAGTTTGGAATGGACTGTCA
                      ____________________________________________________________
consensus CTTGAAAGTTAATTTCAATCTGGATTTTATTATGCTCTACCAGTTTGGAATGGACTGTCA
 
. : . : . : . : . : . :
rJMFF004K03+ GTAACATATGTAAATAT
rJMFF017C24+ GTAACATATGTAAATATTATTTTTGTAATTAATGTTGCGGCTAGCTACAATCATCAATC
rJMFF036H07+ GTAACATATGTAAATATTATTTTTGTAATTAATGTTGCGGCTAGCTACAATCATCAATCA
                      ____________________________________________________________
consensus GTAACATATGTAAATATTATTTTTGTAATTAATGTTGCGGCTAGCTACAATCATCAATCA