Previous Contig 009906:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036G24Sequence547002016 (4)gb:AB019230_15141509e-15Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEB5.693009906 (2)gb:AE016959_10210131e-52Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMSF012B18Sequence212002016 (4)gb:AP004461_18413543e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P044728009906 (2)gb:AE016959_10210135e-93Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012B18+ ATCATAGTCATGATGGGGAGGAAGGTTACCCGGGAGATCTT
                      ____________________________________________________________
consensus ATCATAGTCATGATGGGGAGGAAGGTTACCCGGGAGATCTT
 
. : . : . : . : . : . :
rJMSF012B18+ TCCATTACTGCAACATACAGTCTTACTGCTAAGACAACACTGAGGCTTGACATGGAAGCT
                      ____________________________________________________________
consensus TCCATTACTGCAACATACAGTCTTACTGCTAAGACAACACTGAGGCTTGACATGGAAGCT
 
. : . : . : . : . : . :
rJMSF012B18+ GTTCTTGGAAACAAGGCAACTCCAGTCAGTTTGGCTCAACATACTTATTGGAACCTCGCG
                      ____________________________________________________________
consensus GTTCTTGGAAACAAGGCAACTCCAGTCAGTTTGGCTCAACATACTTATTGGAACCTCGCG
 
. : . : . : . : . : . :
rJMSF012B18+ GGCCACAATTCAGGGGACATTCTCGAACACACTGCTCAGTTGTGGGCTAATCACTATACC
                      ____________________________________________________________
consensus GGCCACAATTCAGGGGACATTCTCGAACACACTGCTCAGTTGTGGGCTAATCACTATACC
 
. : . : . : . : . : . :
rJMSF012B18+ CCGGTGGATCAGAACACTATTCCTACCGGAGAAATAAAGGCGGTTAAAGACACTCCTCCG
rJMFF036G24+ GGAGAAATAAAGGCGGTTAAAGACACTCCTCCG
                      ____________________________________________________________
consensus CCGGTGGATCAGAACACTATTCCTACCGGAGAAATAAAGGCGGTTAAAGACACTCCTCCG
 
. : . : . : . : . : . :
rJMSF012B18+ TTTGATTTCACCACCGAAAAGAAGATTGGCCGAGATATCCAGCAGGTTGGTTTAGGGTAC
rJMFF036G24+ TTTGATTTCACCACCGAAAAGAAGATTGGCCGAGATATCCAGCAGGTTGGTTTAGGGTAC
                      ____________________________________________________________
consensus TTTGATTTCACCACCGAAAAGAAGATTGGCCGAGATATCCAGCAGGTTGGTTTAGGGTAC
 
. : . : . : . : . : . :
rJMSF012B18+ GACCACAACTACGTACTCGACTGTGGAGTCGAGAAGTCCGGGTTGAAGCATGCGGTGAAG
rJMFF036G24+ GACCACAACTACGTACTCGACTGTGGAGTCGAGAAGTCCGGGTTGAAGCATGCGGTGAAG
                      ____________________________________________________________
consensus GACCACAACTACGTACTCGACTGTGGAGTCGAGAAGTCCGGGTTGAAGCATGCGGTGAAG
 
. : . : . : . : . : . :
rJMSF012B18+ ATCAAGGATCCCAAGAGCTGCAGGGTTCTTAACTTATGGACGAACGCCCCTGGGATGCAA
rJMFF036G24+ ATCAAGGATCCCAAGAGCTGCAGGGTTCTTAACTTATGGACGAACGCCCCTGGGATGCAA
                      ____________________________________________________________
consensus ATCAAGGATCCCAAGAGCTGCAGGGTTCTTAACTTATGGACGAACGCCCCTGGGATGCAA
 
. : . : . : . : . : . :
rJMSF012B18+ TTCTACACCGCGAACTATGTGAATGGGGTCGTTGGAAAAGGTGGGGCCGTCTACAATAAG
rJMFF036G24+ TTCTACACCGCGAACTATGTGAATGGGGTCGTTGGAAAAGGTGGGGCCGTCTACAATAAG
                      ____________________________________________________________
consensus TTCTACACCGCGAACTATGTGAATGGGGTCGTTGGAAAAGGTGGGGCCGTCTACAATAAG
 
. : . : . : . : . : . :
rJMSF012B18+ CATGCCGGGGTTTGTTTAGAGACTCAGGGCTTCCCGAATGCTGTCAACACACCGAATTTC
rJMFF036G24+ CATGCCGGGGTTTGTTTAGAGACTCAGGGCTTCCCGAATGCTGTCAACACACCGAATTTC
                      ____________________________________________________________
consensus CATGCCGGGGTTTGTTTAGAGACTCAGGGCTTCCCGAATGCTGTCAACACACCGAATTTC
 
. : . : . : . : . : . :
rJMSF012B18+ CCGTCCGTTATTGTCCAGCCTGGTGAAAAGTATCAACACACCATGGTGTATGAGTTCTCA
rJMFF036G24+ CCGTCCGTTATTGTCCAGCCTGGTGAAAAGTATCAACACACCATGGTGTATGAGTTCTCA
                      ____________________________________________________________
consensus CCGTCCGTTATTGTCCAGCCTGGTGAAAAGTATCAACACACCATGGTGTATGAGTTCTCA
 
. : . : . : . : . : . :
rJMSF012B18+ GTTGAGTAAAAGATGGTAAATTCTGCAATAAAGTTACTGCCTTTATGCACATTTTGCTTC
rJMFF036G24+ GTTGAGTAAAAGATGGTAAATTCTGCAATAAAGTTACTGCCTTTATGCACATTTTGCTTC
                      ____________________________________________________________
consensus GTTGAGTAAAAGATGGTAAATTCTGCAATAAAGTTACTGCCTTTATGCACATTTTGCTTC
 
. : . : . : . : . : . :
rJMSF012B18+ AACCTCACTTTTGGTAATCAGACATCT
rJMFF036G24+ AACCTCACTTTTGGTAATCAGACATCTTTACAGTCTAAATAATTAATGATTACTTCATTT
                      ____________________________________________________________
consensus AACCTCACTTTTGGTAATCAGACATCTTTACAGTCTAAATAATTAATGATTACTTCATTT
 
. : . : . : . : . : . :
rJMFF036G24+ TGCTGTTTATGTTACATGTTATAGTCCTATACATCTAAAGTTGAGGCCATTATTTCATTA
                      ____________________________________________________________
consensus TGCTGTTTATGTTACATGTTATAGTCCTATACATCTAAAGTTGAGGCCATTATTTCATTA
 
. : . : . : . : . : . :
rJMFF036G24+ TAAAGCTATAGGGAAGGGATTAGACTTGTTCGATTGGGTACCACATTACAATTAATCTCG
                      ____________________________________________________________
consensus TAAAGCTATAGGGAAGGGATTAGACTTGTTCGATTGGGTACCACATTACAATTAATCTCG
 
. : . : . : . : . : . :
rJMFF036G24+ TCTTAATTTACATATTTGATGTTGGTATAATGGTATACTTTTGTGGAGTAAATTTATTAA
                      ____________________________________________________________
consensus TCTTAATTTACATATTTGATGTTGGTATAATGGTATACTTTTGTGGAGTAAATTTATTAA