Previous Contig 009903:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030P14Sequence433009903 (5)gb:AB005239_15094441e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLN1.>gb:AY058201_15643715009903 (5)gb:AF083781_17670113e-52Arabidopsis thaliana clone sps810 unknown mRNA.
JMFF036F24Sequence535009903 (5)pir|D86169|D861691e-44hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889406 Arabid667009903 (5)gb:AF083781_17670113e-47Arabidopsis thaliana clone sps810 unknown mRNA.
JMFF037G01Sequence716009903 (5)gb:AF083781_17670113e-52Arabidopsis thaliana clone sps810 unknown mRNA.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030P14- ACCATCACCGC
JMFF036F24- ACCATCACCGC
                      ____________________________________________________________
consensus ACCATCACCGC
 
. : . : . : . : . : . :
JMFF030P14- CGCCGCCACCGCGACCATCACCGCCGCCATTACCGCCGCCGGCACTCTCTAGTATAGGCC
JMFF036F24- CGCCGCCACCGCGACCATCACCGCCGCCATTACCGCCGCCGGCACTCTCTAGTATAGGCC
                      ____________________________________________________________
consensus CGCCGCCACCGCGACCATCACCGCCGCCATTACCGCCGCCGGCACTCTCTAGTATAGGCC
 
. : . : . : . : . : . :
JMFF030P14- AAGAATGGCTAAAGCTGCTGTTTCTTTCATTGTTCTATCATTTTTGTTGGTGGGGTTGGC
JMFF036F24- AAGAATGGCTAAAGCTGCTGTTTCTTTCATTGTTCTATCATTTTTGTTGGTGGGGTTGGC
                      ____________________________________________________________
consensus AAGAATGGCTAAAGCTGCTGTTTCTTTCATTGTTCTATCATTTTTGTTGGTGGGGTTGGC
 
. : . : . : . : . : . :
JMFF030P14- TGAGGTGAAAGCCCAAGCTCCGGCGCCGTCCCCCGGCGGGCCAGTGGACATCTTCGCCGT
JMFF036F24- TGAGGTGAAAGCCCAAGCTCCGGCGCCGTCCCCCGGCGGGCCAGTGGACATCTTCGCCGT
                      ____________________________________________________________
consensus TGAGGTGAAAGCCCAAGCTCCGGCGCCGTCCCCCGGCGGGCCAGTGGACATCTTCGCCGT
 
. : . : . : . : . : . :
JMFF030P14- GTTGAAAAAGGCCGGCGGGCAATTTGGCATCTTCATCAAGTTCCTGAACACTACCCAAGT
JMFF036F24- GTTGAAAAAGGCCGGCGGGCAATTTGGCATCTTCATCAAGTTCCTGAACACTACCCAAGT
rJMFF030P14+ TGAAAAAGGCCGGCGGGCAATTTGGCATCTTCATCAAGTTCCTGAACACTACCCAAGT
rJMFF037G01+ TGAAAAAGGCCGGCGGGCAATTTGGCATCTTCATCAAGTTCCTGAACACTACCCAAGT
rJMFF036F24+ CCCAAGT
                      ____________________________________________________________
consensus GTTGAAAAAGGCCGGCGGGCAATTTGGCATCTTCATCAAGTTCCTGAACACTACCCAAGT
 
. : . : . : . : . : . :
JMFF030P14- GGGGAACCAGGTCAACATCCAAGTCAACAGCCCCACTGATGGGATGACTGTGTTTGCCCC
JMFF036F24- GGGGAACCAGGTCAACATCCAAGTCAACAGCCCCACTGATGGGATGACTGTGTTTGCCCC
rJMFF030P14+ GGGGAACCAGGTCAACATCCAAGTCAACAGCCCCACTGATGGGATGACTGTGTTTGCCCC
rJMFF037G01+ GGGGAACCAGGTCAACATCCAAGTCAACAGCCCCACTGATGGGATGACTGTGTTTGCCCC
rJMFF036F24+ GGGGAACCAGGTCAACATCCAAGTCAACAGCCCCACTGATGGGATGACTGTGTTTGCCCC
                      ____________________________________________________________
consensus GGGGAACCAGGTCAACATCCAAGTCAACAGCCCCACTGATGGGATGACTGTGTTTGCCCC
 
. : . : . : . : . : . :
JMFF030P14- CACTGATAATGCCTTCAACAATCTCCCTTCCGGCACCCTCAACAAGCTCTCCGACCAGCA
JMFF036F24- CACTGATAATGCCTTCAACAATCTCCCTTCCGGCACCCTCAACAAGCTCTCCGACCAGCA
rJMFF030P14+ CACTGATAATGCCTTCAACAATCTCCCTTCCGGCACCCTCAACAAGCTCTCCGACCAGCA
rJMFF037G01+ CACTGATAATGCCTTCAACAATCTCCCTTCCGGCACCCTCAACAAGCTCTCCGACCAGCA
rJMFF036F24+ CACTGATAATGCCTTCAACAATCTCCCTTCCGGCACCCTCAACAAGCTCTCCGACCAGCA
                      ____________________________________________________________
consensus CACTGATAATGCCTTCAACAATCTCCCTTCCGGCACCCTCAACAAGCTCTCCGACCAGCA
 
. : . : . : . : . : . :
JMFF030P14- GAAAATCTTGCTCATTCAGTACCATGTTATCCCTAAATTCTACTCCTTTGAAGATCTTCA
JMFF036F24- GAAAATCTTGCTCATTCAGTACCATGTTATCCCTAAATTCTACTCCTTTGAAGATCTTCA
rJMFF030P14+ GAAAATCTTGCTCATTCAGTACCATGTTATCCCTAAATTCTACTCCTTTGAAGATCTTCA
rJMFF037G01+ GAAAATCTTGCTCATTCAGTACCATGTTATCCCTAAATTCTACTCCTTTGAAGATCTTCA
rJMFF036F24+ GAAAATCTTGCTCATTCAGTACCATGTTATCCCTAAATTCTACTCCTTTGAAGATCTTCA
                      ____________________________________________________________
consensus GAAAATCTTGCTCATTCAGTACCATGTTATCCCTAAATTCTACTCCTTTGAAGATCTTCA
 
. : . : . : . : . : . :
JMFF030P14- GA
JMFF036F24- GACCGTCAGCAACCCCGTCAGAACTCAGGCTAACGGGCCAGATGGAAAGACATACGGGCT
rJMFF030P14+ GACCGTCAGCAACCCCGTCAGAACTCAGGCTAACGGGCCAGATGGAAAGACATACGGGCT
rJMFF037G01+ GACCGTCAGCAACCCCGTCAGAACTCAGGCTAACGGGCCAGATGGAAAGACATACGGGCT
rJMFF036F24+ GACCGTCAGCAACCCCGTCAGAACTCAGGCTAACGGGCCAGATGGAAAGACATACGGGCT
                      ____________________________________________________________
consensus GACCGTCAGCAACCCCGTCAGAACTCAGGCTAACGGGCCAGATGGAAAGACATACGGGCT
 
. : . : . : . : . : . :
JMFF036F24- GAACTTCACCGGCCAGAACAACCAAGTGAACGTGTCTTCCGGGG
rJMFF030P14+ GAACTTCACCGGCCAGAACAACCAAGTGAACGTGTCTTCCGGGGCGGTGGAGACTCAAGT
rJMFF037G01+ GAACTTCACCGGCCAGAACAACCAAGTGAACGTGTCTTCCGGGGCGGTGGAGACTCAAGT
rJMFF036F24+ GAACTTCACCGGCCAGAACAACCAAGTGAACGTGTCTTCCGGGGCGGTGGAGACTCAAGT
                      ____________________________________________________________
consensus GAACTTCACCGGCCAGAACAACCAAGTGAACGTGTCTTCCGGGGCGGTGGAGACTCAAGT
 
. : . : . : . : . : . :
rJMFF030P14+ TTATAACCCTTTGAGAAAAGACCCTCCGTTGGCTGTTTATCATGTTGATAAGGTTTTGGT
rJMFF037G01+ TTATAACCCTTTGAGAAAAGACCCTCCGTTGGCTGTTTATCATGTTGATAAGGTTTTGGT
rJMFF036F24+ TTATAACCCTTTGAGAAAAGACCCTCCGTTGGCTGTTTATCATGTTGATAAGGTTTTGGT
                      ____________________________________________________________
consensus TTATAACCCTTTGAGAAAAGACCCTCCGTTGGCTGTTTATCATGTTGATAAGGTTTTGGT
 
. : . : . : . : . : . :
rJMFF030P14+ GCCGCTGGACTTCACTGCCGATCATCCGGCGGCGAAGGCTCCCACCGGATCCGCCTCATC
rJMFF037G01+ GCCGCTGGACTTCACTGCCGATCATCCGGCGGCGAAGGCTCCCACCGGATCCGCCTCATC
rJMFF036F24+ GCCGCTGGACTTCACTGCCGATCATCCGGCGGCGAAGGCTCCCACCGGATCCGCCTCATC
                      ____________________________________________________________
consensus GCCGCTGGACTTCACTGCCGATCATCCGGCGGCGAAGGCTCCCACCGGATCCGCCTCATC
 
. : . : . : . : . : . :
rJMFF030P14+ TACGCCTGCCGGCAAGAGCAACGACGGGAAGAATGCGACGGCAGCCAAAGAGCCGTCTCC
rJMFF037G01+ TACGCCTGCCGGCAAGAGCAACGACGGGAAGAATGCGACGGCAGCCAAAGAGCCGTCTCC
rJMFF036F24+ TACGCCTGCCGGCAAGAGCAACGACGGGAAGAATGCGACGGCAGCCAAAGAGCCGTCTCC
                      ____________________________________________________________
consensus TACGCCTGCCGGCAAGAGCAACGACGGGAAGAATGCGACGGCAGCCAAAGAGCCGTCTCC
 
. : . : . : . : . : . :
rJMFF030P14+ TGCTCCAAACGGTGCCGGAAAGATGAGCTTGGAGCTGGGTTTGGTTACTGGAATCTTGGT
rJMFF037G01+ TGCTCCAAACGGTGCCGGAAAGATGAGCTTGGAGCTGGGTTTGGTTACTGGAATCTTGGT
rJMFF036F24+ TGCTCCAAACGGTGCCGGAAAGATGAGCTTGGAGCTGGGTTTGGTTACTGGAATCTTGGT
                      ____________________________________________________________
consensus TGCTCCAAACGGTGCCGGAAAGATGAGCTTGGAGCTGGGTTTGGTTACTGGAATCTTGGT
 
. : . : . : . : . : . :
rJMFF030P14+ GTTTTGTATGGGATTGCTTTCTTGAGGAGATAAGATGGATATGCATGTACGTTATTGATT
rJMFF037G01+ GTTTTGTATGGGATTGCTTTCTTGAGGAGATAAGATGGATATGCATGTACGTTATTGATT
rJMFF036F24+ GTTTTGTATGGGATTGCTTTCTTGAGGAGATAAGATGGATATGCATGTACGTTATTGATT
                      ____________________________________________________________
consensus GTTTTGTATGGGATTGCTTTCTTGAGGAGATAAGATGGATATGCATGTACGTTATTGATT
 
. : . : . : . : . : . :
rJMFF030P14+ ATTCTGTATGTTTGTTCTTGTAGAACATTATTTAATTTCATCATTGTTTTCTTTTTA
rJMFF037G01+ ATTCTGTATGTTTGTTCTTGTAGAACATTATTTAATTTCATCATTGTTTTCTTTTTA
rJMFF036F24+ ATTCTGTATGTTTGTTCTTGTAGAACATTATTTAATTTCATCATTGTTTTCTTTTTATCT
                      ____________________________________________________________
consensus ATTCTGTATGTTTGTTCTTGTAGAACATTATTTAATTTCATCATTGTTTTCTTTTTATCT