Previous Contig 009899:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005O16Sequence481000289 (23)gb:CAV417975_16456195e-36Corylus avellana lox gene for lipoxygenase, exons 1-9.750009899 (3)pir|T07775|T077754e-89lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF030M17Sequence396000289 (23)pir|S57964|S579643e-21lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro481009899 (3)pir|T07775|T077751e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF036E19Sequence489004074 (328)pir|S57964|S579647e-60lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro739009899 (3)pir|T07775|T077754e-88lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005O16+ GATTACTGCAACTTTTACTACAAGGATGATTCCATGGTTTT
rJMFF036E19+ AAGGATGATTCCATGGTTTT
                      ____________________________________________________________
consensus GATTACTGCAACTTTTACTACAAGGATGATTCCATGGTTTT
 
. : . : . : . : . : . :
rJMFF005O16+ GCAGGACAAAGAGCTACAAAGCCTGGTGGACCGAAACTGTACAGAAGGGGCACGAGGACA
rJMFF036E19+ GCAGGACAAAGAGCTAC-AAGCCTGGTGGACCGAAACTGTACAGAAGGGGCACGAGGACA
                      ____________________________________________________________
consensus GCAGGACAAAGAGCTACAAAGCCTGGTGGACCGAAACTGTACAGAAGGGGCACGAGGACA
 
. : . : . : . : . : . :
rJMFF005O16+ AGAAAAACGAGCCATGGTGGCCTAAAATGACCTCTCGCCAGGTCCTAATCGAGACCCTCA
rJMFF036E19+ AGAAAAACGAGCCATGGTGGCNTAAAATGACCTCTCGCCAGGTCCTAATCGAGACCCTCA
                      ____________________________________________________________
consensus AGAAAAACGAGCCATGGTGGCCTAAAATGACCTCTCGCCAGGTCCTAATCGAGACCCTCA
 
. : . : . : . : . : . :
rJMFF005O16+ CAACCATCATCTGGATCTCTTCAGCCCTCCACGCAGCCGTCAATTTCGGGCAGTATTCCT
rJMFF036E19+ CAACCATCATCTGGATCTCTTCAGCCCTCCACGCAGCCGTCAATTTCGGGCAGTATTCCT
                      ____________________________________________________________
consensus CAACCATCATCTGGATCTCTTCAGCCCTCCACGCAGCCGTCAATTTCGGGCAGTATTCCT
 
. : . : . : . : . : . :
rJMFF030M17+ CGCCCAACGTTGAGCCGCAGGTTCATGCCGGAGCCCGGGA
rJMFF005O16+ ACGCCGGCTACAACCCCTGCCGCCCAACGTTGAGCCGCAGGTTCATGCCGGAGCCCGGGA
rJMFF036E19+ ACGCCGGCTACAACCCCTGCCGCCCAACGTTGAGCCGCAGGTTCATGCCGGAGCCCGGGA
                      ____________________________________________________________
consensus ACGCCGGCTACAACCCCTGCCGCCCAACGTTGAGCCGCAGGTTCATGCCGGAGCCCGGGA
 
. : . : . : . : . : . :
rJMFF030M17+ CGCCCGAGTACGAGGAACTGAAAACCAACCCGGATAAGGCATTCCTGGAAACGATCACTG
rJMFF005O16+ CGCCCGAGTACGAGGAACTGAAAACCAACCCGGATAAGGCATTCCTGGAAACGATCACTG
rJMFF036E19+ CGCCCGAGTACGAGGAACTGAAAACCAACCCGGATAAGGCATTCCTGGAAACGATCACTG
                      ____________________________________________________________
consensus CGCCCGAGTACGAGGAACTGAAAACCAACCCGGATAAGGCATTCCTGGAAACGATCACTG
 
. : . : . : . : . : . :
rJMFF030M17+ CCCAGTTCCAAACCCTGCTGGGGATTTCCCTGATTGAGATCCTGTCCAGGCACGCTTCCG
rJMFF005O16+ CCCAGTTCCAAACCCTGCTGGGGATTTCCCTGATTGAGATCCTGTCCAGGCACGCTTCCG
rJMFF036E19+ CCCAGTTCCAAACCCTGCTGGGGATTTCCCTGATTGAGATCCTGTCCAGGCACGCTTCCG
                      ____________________________________________________________
consensus CCCAGTTCCAAACCCTGCTGGGGATTTCCCTGATTGAGATCCTGTCCAGGCACGCTTCCG
 
. : . : . : . : . : . :
rJMFF030M17+ ATGAGATTTACCTCGGGCAAAGAGAGCACCCGGAGTGGACGAGCGACAAACACGTTCTGG
rJMFF005O16+ ATGAGATTTACCTCGGGCAAAGAGAGCACCCGGAGTGGACGAGCGACAAACACGTTCTGG
rJMFF036E19+ ATGAGATTTACCTCGGGCAAAGAGAGCACCCGGAGTGGACGAGCGACAAACACGTTCTGG
                      ____________________________________________________________
consensus ATGAGATTTACCTCGGGCAAAGAGAGCACCCGGAGTGGACGAGCGACAAACACGTTCTGG
 
. : . : . : . : . : . :
rJMFF030M17+ ACGCGTTTGAGAGATTTGGGAAGAAACTAGCCGCCATTGAGGACCGTATACTAGCCATGA
rJMFF005O16+ ACGCGTTTGAGAGATTTGGGAAGAAACTAGCCGCCATTGAGGACCGTATACTAGCCATGA
rJMFF036E19+ ACGCGTTTGAGAGATTTGGGAAGAAACTAGCCGCCATTGAGGACCGTATACTAGCCATGA
                      ____________________________________________________________
consensus ACGCGTTTGAGAGATTTGGGAAGAAACTAGCCGCCATTGAGGACCGTATACTAGCCATGA
 
. : . : . : . : . : . :
rJMFF030M17+ ATGATGATCAGAAATGGAGGAACAGAACCGGGCCTGTTAAGGTCCCCTACACTTTGCTCT
rJMFF005O16+ ATGATGATCAGAAATGGAGGAACAGAACCGGGCCTGTTAAGGTCCCCTACACTTTGCTCT
rJMFF036E19+ ATGATGATCAGAAATGGAGGAACAGAACCGGGCCTGTTAAGGTCCCCTACACTTTGCTCT
                      ____________________________________________________________
consensus ATGATGATCAGAAATGGAGGAACAGAACCGGGCCTGTTAAGGTCCCCTACACTTTGCTCT
 
. : . : . : . : . : . :
rJMFF030M17+ TCCCAACAAGTGAAGGAGGGCTCACCGGAAGAGGAATTCCTAACAGCATTTCTATATAAT
rJMFF005O16+ TCCCAACAAGTGAAGGAGGGCTCACCGGAAGAGGAATTCCTAACAGCATTTCTATATAAT
rJMFF036E19+ TCCCAACAAGTGAAGGAGGGCTCACCGGAAGAGGAATTCCTAACAGCATTTCTATATAAT
                      ____________________________________________________________
consensus TCCCAACAAGTGAAGGAGGGCTCACCGGAAGAGGAATTCCTAACAGCATTTCTATATAAT
 
. : . : . : . : . : . :
rJMFF030M17+ TCTTTCAATTCGAAACATCTGATCTATGCTCTTAATCTTTGACTGTTTAAGTGTGCTGTT
rJMFF005O16+ TCTTTCAATTCGAAACATCTGATCTATGCTCTTAATCTTTGACTGTTTAAGTGTGCTGTT
rJMFF036E19+ TCTTTCAATTCGAAACATCTTATCTATGCTCTTAATCTTTGACTGTTTAAGTGTGCTGTT
                      ____________________________________________________________
consensus TCTTTCAATTCGAAACATCTGATCTATGCTCTTAATCTTTGACTGTTTAAGTGTGCTGTT
 
. : . : . : . : . : . :
rJMFF030M17+ TCTGCATATTTCTTGCTTTCC
rJMFF005O16+ TCTGCATATTTCTTGCTTTCCTTTTTCCTGCAATGTACCACATCATCAT
rJMFF036E19+ TCTGCATATTTCTTGCTTTCCTTTTTCCTGCAATGTACCACATCATCATTATAANAAAAG
                      ____________________________________________________________
consensus TCTGCATATTTCTTGCTTTCCTTTTTCCTGCAATGTACCACATCATCATTATAANAAAAG