Previous Contig 009895:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023I03Sequence398001148 (3)gb:INU55867_16831735e-30Ipomoea nil petal abundant lipase-like protein Pn47p mRNA, complete cds.747009895 (3)gb:INU55867_16831733e-41Ipomoea nil petal abundant lipase-like protein Pn47p mRNA, complete cds.
JMFF023I23Sequence377001148 (3)gb:INU55867_16831733e-28Ipomoea nil petal abundant lipase-like protein Pn47p mRNA, complete cds.693009895 (3)gb:INU55867_16831735e-35Ipomoea nil petal abundant lipase-like protein Pn47p mRNA, complete cds.
JMFF036C16Sequence487001148 (3)gb:INU55867_16831733e-46Ipomoea nil petal abundant lipase-like protein Pn47p mRNA, complete cds.686009895 (3)gb:INU55867_16831739e-33Ipomoea nil petal abundant lipase-like protein Pn47p mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023I03+ GCANCACTAAATGCAGTTGACCTAGCTGCCAATCCATT
                      ____________________________________________________________
consensus GCANCACTAAATGCAGTTGACCTAGCTGCCAATCCATT
 
. : . : . : . : . : . :
rJMFF023I03+ CAACAACACCGATGTTCTTATCACAGCATTCTTGTTCGCAAGCCCCAAAGTGGGAAACGG
rJMFF023I23+ TCACAGCATTTTTGTTCGCAAGCCCCAAAGTGGGAAACGA
rJMFF036C16+ TTCGCAAGCCCCAAAGTGGGAAACGA
                      ____________________________________________________________
consensus CAACAACACCGATGTTCTTATCACAGCATTTTTGTTCGCAAGCCCCAAAGTGGGAAACGA
 
. : . : . : . : . : . :
rJMFF023I03+ GGGTTTCAAGAAGGCTTTTTCCCACCTGAAAAACCTCCGAGCTCTTCGAGTCGTTAACAA
rJMFF023I23+ GGGTTTCAAGAAGGCTTTTTCCCACCTGAAAAACCTCCGAGCTCTTCGAGTCGTTAACAA
rJMFF036C16+ GGNTTTCAAGAAGGCTTTTTCCCACCTGAAAAACCTCCGAGCTCTTCGAGTCGTTAACAA
                      ____________________________________________________________
consensus GGGTTTCAAGAAGGCTTTTTCCCACCTGAAAAACCTCCGAGCTCTTCGAGTCGTTAACAA
 
. : . : . : . : . : . :
rJMFF023I03+ TGGGGATCTTGTGCCAATGGTGCCATTCTTGGCTGTTGAAGCCGGGACTATTTTACCCCT
rJMFF023I23+ TGGGGATCTTGTGCCAATGGTGCCATTCTTGGCTGTTGAAGCCGGGACTATTTTACCCCT
rJMFF036C16+ TGGGGATCTTGTGCCAATGGTGCCATTCTTGGCTGTTGAAGCCGGGACTATTTTACCCCT
                      ____________________________________________________________
consensus TGGGGATCTTGTGCCAATGGTGCCATTCTTGGCTGTTGAAGCCGGGACTATTTTACCCCT
 
. : . : . : . : . : . :
rJMFF023I03+ CATAGCCTACAAAGACGTGGGAGTCCAATTTGATATAAACGCTTCAAAATCAGAGTATGT
rJMFF023I23+ CATAGCCTACAAAGACGTGGGAGTCCAATTTGATATAAACGCTTCAAAATCAGAGTATGT
rJMFF036C16+ CATAGCCTACAAAGACGTGGGAGTCCAATTTGATATAAACGCTTCAAAATCAGAGTATGT
                      ____________________________________________________________
consensus CATAGCCTACAAAGACGTGGGAGTCCAATTTGATATAAACGCTTCAAAATCAGAGTATGT
 
. : . : . : . : . : . :
rJMFF023I03+ AAAGCATGATAAGTTGAACGTGTTAATGTGGCATGGGCTGATGATTTATCTGCATGGAAT
rJMFF023I23+ AAAGCATGATAAGTTGAACGTGTTAATGTGGCATGGGCTGATGATTTATCTGCATGGAAT
rJMFF036C16+ AAAGCATGATAAGTTGAACGTGTTAATGTGGCATGGGCTGATGATTTATCTGCATGGAAT
                      ____________________________________________________________
consensus AAAGCATGATAAGTTGAACGTGTTAATGTGGCATGGGCTGATGATTTATCTGCATGGAAT
 
. : . : . : . : . : . :
rJMFF023I03+ CGATGGGTTTCAAGGACCGAAGGGAGAGTTTAAACCACAAGGGTGTTTTGGTATCCCTCA
rJMFF023I23+ CGATGGGTTTCAAGGACCGAAGGGAGAGTTTAAACCACAAGGGTGTTTTGATATCCCTCA
rJMFF036C16+ CGATGGGTTTCAAGGACCGAAGGGAGAGTTTAAACCACAAGGGTGTTTTGATATCCCTCA
                      ____________________________________________________________
consensus CGATGGGTTTCAAGGACCGAAGGGAGAGTTTAAACCACAAGGGTGTTTTGATATCCCTCA
 
. : . : . : . : . : . :
rJMFF023I03+ AGTCAACAAGTATGGAGGCATGCTGAAAGCTGAGAAATGCCCGGTTCCAACTGAATGGTG
rJMFF023I23+ AGTCAACAAGTATGGAGGCATGCTGAAAGTTGAGAAATGCCCGGTTCCAACTGAATGGTG
rJMFF036C16+ AGTCAACAAGTATGGAGGCATGCTGAAAGTTGAGAAATGCCCGGTTCCAACTGAATGGTG
                      ____________________________________________________________
consensus AGTCAACAAGTATGGAGGCATGCTGAAAGTTGAGAAATGCCCGGTTCCAACTGAATGGTG
 
. : . : . : . : . : . :
rJMFF023I03+ GGTCGAGAAGAACAAAGGAATGGTTCAGCAAGATGACGGTACCTGGATTCTTGATGATCA
rJMFF023I23+ GGTCGAGAAGAACAAAGGAATGGTTCAGCAAGATGACGGTACCTGGATTCTTGATGATCA
rJMFF036C16+ GGTCGAGAAGAACAAAGGAATGGTTCAGCAAGATGACGGTACCTGGATTCTTGATGATCA
                      ____________________________________________________________
consensus GGTCGAGAAGAACAAAGGAATGGTTCAGCAAGATGACGGTACCTGGATTCTTGATGATCA
 
. : . : . : . : . : . :
rJMFF023I03+ CGAGGCAGACCATGTTGTGTTCGCATAAATTAAACCCTTTCATGGTGGGATACTATTGAT
rJMFF023I23+ CGAGGCAGACCATGTTGTGTTCGCATAAATTAAACCCTTTCATGGTGGGATACTATTGAT
rJMFF036C16+ CGAGGCAGACCATGTTGTGTTCGCATAAATTAAACCCTTTCATGGTGGGATACTATTGAT
                      ____________________________________________________________
consensus CGAGGCAGACCATGTTGTGTTCGCATAAATTAAACCCTTTCATGGTGGGATACTATTGAT
 
. : . : . : . : . : . :
rJMFF023I03+ ATGATTTTAATAAGGTATGAATAAAGTTTGTTTGTGTGTTAGTTGTTTAAGCAAGGGAAC
rJMFF023I23+ ATGATTTTAATAAGGTATGAATAAAGTTTGTTTGTGTGTTAGTTGTTTAAGCAAGGGAAC
rJMFF036C16+ ATGATTTTAATAAGGTATGAATAAAGTTTGTTTGTGTGTTAGTTGTTTAAGCAAGGGAAC
                      ____________________________________________________________
consensus ATGATTTTAATAAGGTATGAATAAAGTTTGTTTGTGTGTTAGTTGTTTAAGCAAGGGAAC
 
. : . : . : . : . : . :
rJMFF023I03+ TATAATGTCACATATATGTTGTTCATCATCTACGTTGTGCGTGTAGAGTTGCCTTTCCTG
rJMFF023I23+ TATAATGTCACATATATGTTGTTCATCATCTACGTTGTGCGTGTAGAGTTGCCTTTCCTG
rJMFF036C16+ TATAATGTCACATATATGTTGTTCATCATCTACGTTGTGCGTGTAGAGTTGCCTTTCCTG
                      ____________________________________________________________
consensus TATAATGTCACATATATGTTGTTCATCATCTACGTTGTGCGTGTAGAGTTGCCTTTCCTG
 
. : . : . : . : . : . :
rJMFF023I03+ TTTTCCAACGCCATTATTGGCGAACTTAATTGCATTGTACTGCTTTGTG
rJMFF023I23+ TTTTCCAACGCCATTATTGGCGAACTTAATTGCATTGTACTGCTTTGTG
rJMFF036C16+ TTTTCCAACGCCATTATTGGCGAACTTAATTGCATTGTACTGCTTTGTGTATGTGAATAA
                      ____________________________________________________________
consensus TTTTCCAACGCCATTATTGGCGAACTTAATTGCATTGTACTGCTTTGTGTATGTGAATAA