Previous Contig 009890:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036B01Sequence427009890 (2)gb:AC104713_17378450.024Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11, complete s542009890 (2)gb:AC104713_17378456e-35Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036B01- ACGTTTGGATTCAGATCTCAGTCACACTCGCAGATACACTTTC
                      ____________________________________________________________
consensus ACGTTTGGATTCAGATCTCAGTCACACTCGCAGATACACTTTC
 
. : . : . : . : . : . :
JMFF036B01- TATTCGTCACCACAATCCATTTTCTTAATTTCTTCCCTGCGATCTAAGGCTTAATTTGGA
                      ____________________________________________________________
consensus TATTCGTCACCACAATCCATTTTCTTAATTTCTTCCCTGCGATCTAAGGCTTAATTTGGA
 
. : . : . : . : . : . :
JMFF036B01- ATTCTGAGAGTTCGGTTGCTATGAGAGAACGGAGCAACGGGCTGAGGAATTTGGCTACTC
                      ____________________________________________________________
consensus ATTCTGAGAGTTCGGTTGCTATGAGAGAACGGAGCAACGGGCTGAGGAATTTGGCTACTC
 
. : . : . : . : . : . :
JMFF036B01- CTGATAAAGGAGGTGCGCACGATAAGAGAGGCGGTGGTGGTGGTGCGCATAATAACAATC
                      ____________________________________________________________
consensus CTGATAAAGGAGGTGCGCACGATAAGAGAGGCGGTGGTGGTGGTGCGCATAATAACAATC
 
. : . : . : . : . : . :
JMFF036B01- ATACCAGGGCGAGTCACAATAATAATGATCACCACCACC--ACCACGGCGGCGCTGGTGG
rJMFF036B01+ CAGGGNGAGTCACAATAATAATGATNANCACCACCCACCCACGGCGGCGGTGGTGG
                      ____________________________________________________________
consensus ATACCAGGGCGAGTCACAATAATAATGATCACCACCACCCACCCACGGCGGCGGTGGTGG
 
. : . : . : . : . : . :
JMFF036B01- GTCGGTTTCATCGGAAACGGCCCATGAGAGCAAGAAAGGAGGGTCCTCCTCCGGCAGTGA
rJMFF036B01+ GTCGGTTTCATCGGAAACGGCCCATGAGAGCAAGAAAGGAGGGTCCTCCTCCGGCAGTGA
                      ____________________________________________________________
consensus GTCGGTTTCATCGGAAACGGCCCATGAGAGCAAGAAAGGAGGGTCCTCCTCCGGCAGTGA
 
. : . : . : . : . : . :
JMFF036B01- TGCAATTCCGGCGGTTTGGCCGCCTAAGTTCGTTATCGCGCTTACCAATAAGGAGAAAGA
rJMFF036B01+ TGCAATTCCGGCGGTTTGGCCGCCTAAGTTCGTTATCGCGCTTACCAATAAGGAGAAAGA
                      ____________________________________________________________
consensus TGCAATTCCGGCGGTTTGGCCGCCTAAGTTCGTTATCGCGCTTACCAATAAGGAGAAAGA
 
. : . : . : . : . : . :
JMFF036B01- GGAGGATTTCATGGCCATCAAAGGAT
rJMFF036B01+ GGAGGATTTCATGGCCATCAAAGGATCCAAGCTTCCTCAGCGACCCAAAAAACGAGCCAA
                      ____________________________________________________________
consensus GGAGGATTTCATGGCCATCAAAGGATCCAAGCTTCCTCAGCGACCCAAAAAACGAGCCAA
 
. : . : . : . : . : . :
rJMFF036B01+ ATTCATCCAGCGTACTCTCAATTTAATTAGTCCTGGAGCATGGCTATGCGATCTTTCCCT
                      ____________________________________________________________
consensus ATTCATCCAGCGTACTCTCAATTTAATTAGTCCTGGAGCATGGCTATGCGATCTTTCCCT
 
. : . : . : . : . : . :
rJMFF036B01+ CGAGCGGTATGAAGTAAGAGAGAAAAAGGTCTCCAAGAAGAGACCTAGAGGGTTGAAGGC
                      ____________________________________________________________
consensus CGAGCGGTATGAAGTAAGAGAGAAAAAGGTCTCCAAGAAGAGACCTAGAGGGTTGAAGGC
 
. : . : . : . : . : . :
rJMFF036B01+ AATGGGAAACATGGATTCCGATTCAGAGTAGAGTGAGCGTTATCCGAAAGAAAAAGTTGG
                      ____________________________________________________________
consensus AATGGGAAACATGGATTCCGATTCAGAGTAGAGTGAGCGTTATCCGAAAGAAAAAGTTGG
 
. : . : . : . : . : . :
rJMFF036B01+ TGGATTAAGTAATGTATTTGATGGATTTTGAGGTGGAGAAGAAGAATGAATATGATAAAT
                      ____________________________________________________________
consensus TGGATTAAGTAATGTATTTGATGGATTTTGAGGTGGAGAAGAAGAATGAATATGATAAAT