Previous Contig 009886:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035P22Sequence536009886 (2)734009886 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035P22- ATAATAAAAGATCGTCGTCGTTCTCGCTTGATCTCCGATCATCTTA
                      ____________________________________________________________
consensus ATAATAAAAGATCGTCGTCGTTCTCGCTTGATCTCCGATCATCTTA
 
. : . : . : . : . : . :
JMFF035P22- TTTGTTTCTGGAACGTGAACTCTCAAAATAGCAAAGCAAATCAAGCTTAGCGATCGAGAT
                      ____________________________________________________________
consensus TTTGTTTCTGGAACGTGAACTCTCAAAATAGCAAAGCAAATCAAGCTTAGCGATCGAGAT
 
. : . : . : . : . : . :
JMFF035P22- TTGTTTCTCCTTTCAGGAATTGTCCAGAATAACTTGTTTGGACTCATCTGGACTCGAATC
rJMFF035P22+ ATCTGGACTCGAATC
                      ____________________________________________________________
consensus TTGTTTCTCCTTTCAGGAATTGTCCAGAATAACTTGTTTGGACTCATCTGGACTCGAATC
 
. : . : . : . : . : . :
JMFF035P22- AACTCATCAATTCACTCGGTTGGGACTATTGCTCTTCTTGCTTGACAGGATTGCTAATTT
rJMFF035P22+ AACTCATCAATTCACTCGGTTGGGACTATTGCTCTTCTTGCTTGACAGGATTGCTAATTT
                      ____________________________________________________________
consensus AACTCATCAATTCACTCGGTTGGGACTATTGCTCTTCTTGCTTGACAGGATTGCTAATTT
 
. : . : . : . : . : . :
JMFF035P22- ATATTGTTTTCTTTGTCTTGACCGTGACAACTATCAATGCTGTGTTGTAGTCTCTCTTTT
rJMFF035P22+ ATATTGTTTTCTTTGTCTTGACCGTGACAACTATCAATGCTGTGTTGTAGTCTCTCTTTT
                      ____________________________________________________________
consensus ATATTGTTTTCTTTGTCTTGACCGTGACAACTATCAATGCTGTGTTGTAGTCTCTCTTTT
 
. : . : . : . : . : . :
JMFF035P22- CATTCCTTTAGCAGCAGTAGATGGATTCTTTACTTATTTAATAGGCATTTATGTTGGGCT
rJMFF035P22+ CATTCCTTTAGCAGCAGTAGATGGATTCTTTACTTATTTAATAGGCATTTATGTTGGGCT
                      ____________________________________________________________
consensus CATTCCTTTAGCAGCAGTAGATGGATTCTTTACTTATTTAATAGGCATTTATGTTGGGCT
 
. : . : . : . : . : . :
JMFF035P22- TAGGATCGCTAGTGTTGCGAATGCTATTGTTTAGAGTCATTATCTGAAGTGGTTTGTGAT
rJMFF035P22+ TAGGATCGCTAGTGTTGCGAATGCTATTGTTTAGAGTCATTATCTGAAGTGGTTTGTGAT
                      ____________________________________________________________
consensus TAGGATCGCTAGTGTTGCGAATGCTATTGTTTAGAGTCATTATCTGAAGTGGTTTGTGAT
 
. : . : . : . : . : . :
JMFF035P22- TTTATTTTGCTTGGTTTAAGACTTGGGAAGTTGAAGTTTTGGTTCAGTGATCCATGATAG
rJMFF035P22+ TTTATTTTGCTTGGTTTAAGACTT-GGAAGTTGAAGTTTTGGTTCAGTGATCCATGATAG
                      ____________________________________________________________
consensus TTTATTTTGCTTGGTTTAAGACTTGGGAAGTTGAAGTTTTGGTTCAGTGATCCATGATAG
 
. : . : . : . : . : . :
JMFF035P22- ATCACATTACTTGGCTATCAGAAAGATTGTAATACTCAGAACCTTTTGTTTAGTGTATAT
rJMFF035P22+ ATCACATTACTTGGCTATCAGAAAGATTGTAATACTCAGAACCTTTTGTTTAGTGTATAT
                      ____________________________________________________________
consensus ATCACATTACTTGGCTATCAGAAAGATTGTAATACTCAGAACCTTTTGTTTAGTGTATAT
 
. : . : . : . : . : . :
JMFF035P22- TTGAATCGGG
rJMFF035P22+ TTGAATCGGGTGGGGATTGGGGAATTTTTTTAATACTGCGTGGGGTCGGGGTCAGGAACA
                      ____________________________________________________________
consensus TTGAATCGGGTGGGGATTGGGGAATTTTTTTAATACTGCGTGGGGTCGGGGTCAGGAACA
 
. : . : . : . : . : . :
rJMFF035P22+ AGAGCAGAGAGCGGAGGGTGAAGTCTGGCTTCCCTGTTGACATCCTTAACTAATAACTGT
                      ____________________________________________________________
consensus AGAGCAGAGAGCGGAGGGTGAAGTCTGGCTTCCCTGTTGACATCCTTAACTAATAACTGT
 
. : . : . : . : . : . :
rJMFF035P22+ GCAGCCACTGTTCTCATATTGATAAAATTTCACATAAATGATTATGGACTGCACTCTGGA
                      ____________________________________________________________
consensus GCAGCCACTGTTCTCATATTGATAAAATTTCACATAAATGATTATGGACTGCACTCTGGA
 
. : . : . : . : . : . :
rJMFF035P22+ ATTGTTTACTTTCAGCTGTAATACTACTAATGAATTTAAACTCTGAGGTTTCATTCTGCT
                      ____________________________________________________________
consensus ATTGTTTACTTTCAGCTGTAATACTACTAATGAATTTAAACTCTGAGGTTTCATTCTGCT
 
. : . : . : . : . : . :
rJMFF035P22+ GCAGATGTTTCCATCAGCAGAAAGAAATCATTTCTTTTCCATCTTGTATACGCTTCTGAT
                      ____________________________________________________________
consensus GCAGATGTTTCCATCAGCAGAAAGAAATCATTTCTTTTCCATCTTGTATACGCTTCTGAT
 
. : . : . : . : . : . :
rJMFF035P22+ TGTTGCACAAGTCTTTCTGTTTGTATTAGTCTGACATTTGAAGCATAATTGTAATAGACT
                      ____________________________________________________________
consensus TGTTGCACAAGTCTTTCTGTTTGTATTAGTCTGACATTTGAAGCATAATTGTAATAGACT