Previous Contig 009880:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004N22Sequence537006359 (3)gb:AY087725_15727537e-12Arabidopsis thaliana clone 3797 mRNA, complete sequence.789009880 (3)gb:AY182168_15878765e-89Elaeis guineensis clone opsc112 protein disulphide isomerase mRNA, partial cds.
JMFF035N21Sequence549006359 (3)gb:AY087725_15727538e-08Arabidopsis thaliana clone 3797 mRNA, complete sequence.731009880 (3)gb:AY182168_15878769e-82Elaeis guineensis clone opsc112 protein disulphide isomerase mRNA, partial cds.
JMSF026D09Sequence641006359 (3)gb:AY087725_15727532e-08Arabidopsis thaliana clone 3797 mRNA, complete sequence.762009880 (3)gb:AY182168_15878761e-91Elaeis guineensis clone opsc112 protein disulphide isomerase mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026D09+ AAAGCTTATATTTGTGTATATCAA
rJMFF004N22+ TGTATATCAA
                      ____________________________________________________________
consensus AAAGCTTATATTTGTGTATATCAA
 
. : . : . : . : . : . :
rJMSF026D09+ AATTGATGATGAAGATGTTGGAAGGCCTGTAGCAAATTACTTTGGAGTTGAAGGGGATAC
rJMFF004N22+ AATTGATGATGAAGATGTTGGAAGGCCTGTAGCAAATTACTTTGGAGTTGAAGGGGATAC
rJMFF035N21+ GAAGGGGATAC
                      ____________________________________________________________
consensus AATTGATGATGAAGATGTTGGAAGGCCTGTAGCAAATTACTTTGGAGTTGAAGGGGATAC
 
. : . : . : . : . : . :
rJMSF026D09+ TGCAAAGATAATTGGATACTCAGGACTTGAAGATGCTAAGAAATATATCTTTGATGGGGA
rJMFF004N22+ TGCAAAGATAATTGGATACTCAGGACTTGAAGATGCTAAGAAATATATCTTTGATGGGGA
rJMFF035N21+ TGCAAAGATAATTGGATACTCAGGACTTGAAGATGCTAAGAAATATATCTTTGATGGGGA
                      ____________________________________________________________
consensus TGCAAAGATAATTGGATACTCAGGACTTGAAGATGCTAAGAAATATATCTTTGATGGGGA
 
. : . : . : . : . : . :
rJMSF026D09+ GATTACAGTCGAGAAGATTAAGGAATTTGCTGCTAACTTTGTGGAAGACAAGCTCAAACC
rJMFF004N22+ GATTACAGTCGAGAAGATTAAGGAATTTGCTGCTAACTTTGTGGAAGACAAGCTCAAACC
rJMFF035N21+ GATTACAGTCGAGAAGATTAAGGAATTTGCTGCTAACTTTGTGGAAGACAAGCTCAAACC
                      ____________________________________________________________
consensus GATTACAGTCGAGAAGATTAAGGAATTTGCTGCTAACTTTGTGGAAGACAAGCTCAAACC
 
. : . : . : . : . : . :
rJMSF026D09+ TTTCTACAAATCAGATCCCATTCCCGAGACTAACGAAGGGGATGTGAAAATAGTGGTGGG
rJMFF004N22+ TTTCTACAAATCAGATCCCATTCCCGAGACTAACGAAGGGGATGTGAAAATAGTGGTGGG
rJMFF035N21+ TTTCTACAAATCAGATCCCATTCCCGAGACTAACGAAGGGGATGTGAAAATAGTGGTGGG
                      ____________________________________________________________
consensus TTTCTACAAATCAGATCCCATTCCCGAGACTAACGAAGGGGATGTGAAAATAGTGGTGGG
 
. : . : . : . : . : . :
rJMSF026D09+ GAATAATTTTGACGAAATAGTTTTGGATGAGTCAAAAGATGTTCTTCTTGAGATCTATGC
rJMFF004N22+ GAATAATTTTGACGAAATAGTTTTGGATGAGTCAAAAGATGTTCTTCTTGAGATCTATGC
rJMFF035N21+ GAATAATTTTGACGAAATAGTTTTGGATGAGTCAAAAGATGTTCTTCTTGAGATCTATGC
                      ____________________________________________________________
consensus GAATAATTTTGACGAAATAGTTTTGGATGAGTCAAAAGATGTTCTTCTTGAGATCTATGC
 
. : . : . : . : . : . :
rJMSF026D09+ ACCATGGTGTGGCCATTGCCAAGCTTTAGAACCAACATACAACAAGCTTGCCAAGCACTT
rJMFF004N22+ ACCATGGTGTGGCCATTGCCAAGCTTTAGAACCAACATACAACAAGCTTGCCAAGCACTT
rJMFF035N21+ ACCATGGTGTGGCCATTGCCAAGCTTTAGAACCAACATACAACAAGCTTGCCAAGCACTT
                      ____________________________________________________________
consensus ACCATGGTGTGGCCATTGCCAAGCTTTAGAACCAACATACAACAAGCTTGCCAAGCACTT
 
. : . : . : . : . : . :
rJMSF026D09+ ACGAGGCATTGAGTCTCTTGTCATTGCTAAAATGGATGGATCAACAAATGAACACCCTAA
rJMFF004N22+ ACGAGGCATTGAGTCTCTTGTCATTGCTAAAATGGATGGATCAACAAATGAACACCCTAA
rJMFF035N21+ ACGAGGCATTGAGTCTCTTGTCATTGCTAAAATGGATGGATCAACAAATGAACACCCTAA
                      ____________________________________________________________
consensus ACGAGGCATTGAGTCTCTTGTCATTGCTAAAATGGATGGATCAACAAATGAACACCCTAA
 
. : . : . : . : . : . :
rJMSF026D09+ AGCTAAGGCTGAGGGATTTCCAACCATCCTTTTCTTCCCAGCCGGAAACAAGTCTTCTGA
rJMFF004N22+ AGCTAAGGCTGAGGGATTTCCAACCATCCTTTTCTTCCCAGCCGGAAACAAGTCTTCTGA
rJMFF035N21+ AGCTAAGGCTGAGGGATTTCCAACCATCCTTTTCTTCCCAGCCGGAAACAAGTCTTCTGA
                      ____________________________________________________________
consensus AGCTAAGGCTGAGGGATTTCCAACCATCCTTTTCTTCCCAGCCGGAAACAAGTCTTCTGA
 
. : . : . : . : . : . :
rJMSF026D09+ TCCAATTGCTGTCGACTCCGCCAGGACAGTGGTGGCGTTTTACAAGTTTATTAAGAAACA
rJMFF004N22+ TCCAATTGCTGTCGACTCCGCCAGGACAGTGGTGGCGTTTTACAAGTTTATTAAGAAACA
rJMFF035N21+ TCCAATTGCTGTCGACTCCGCCAGGACAGTGGTGGCGTTTTACAAGTTTATTAAGAAACA
                      ____________________________________________________________
consensus TCCAATTGCTGTCGACTCCGCCAGGACAGTGGTGGCGTTTTACAAGTTTATTAAGAAACA
 
. : . : . : . : . : . :
rJMSF026D09+ CGCTGCTATCCCCTTCAAGCTCCAGAAGCCATCAACCTCTACCTCGACTGAGAAGACCGA
rJMFF004N22+ CGCTGCTATCCCCTTCAAGCTCCAGAAGCCATCAACCTCTACCTCGACTGAGAAGACCGA
rJMFF035N21+ CGCTGCTATCCCCTTCAAGCTCCAGAAGCCATCAACCTCTACCTCGACTGAGAAGACCGA
                      ____________________________________________________________
consensus CGCTGCTATCCCCTTCAAGCTCCAGAAGCCATCAACCTCTACCTCGACTGAGAAGACCGA
 
. : . : . : . : . : . :
rJMSF026D09+ AGTCAAAGAAGACGTCAAAAGTTCTTCCGGTAAAGTGAATGATGAATTGTGAGAGCAGAC
rJMFF004N22+ AGTCAAAGAAGACGTCAAAAGTTCTTCCGGTAAAGTGAATGATGAATTGTGAGAGCAGAC
rJMFF035N21+ AGTCAAAGAAGACGTCAAAAGTTCTTCCGGTAAAGTGAATGATGAATTGTGAGAGCAGAC
                      ____________________________________________________________
consensus AGTCAAAGAAGACGTCAAAAGTTCTTCCGGTAAAGTGAATGATGAATTGTGAGAGCAGAC
 
. : . : . : . : . : . :
rJMSF026D09+ GTGTAACATTAATGTAAGATTCCTCTTTAGTTTTTTTGTAACATTTGGAAGTTTTGACAG
rJMFF004N22+ GTGTAACATTAATGTAAGATTCCTCTTTAGTTTTTTTGTAACATTTGGAAGTTTTGACAG
rJMFF035N21+ GTGTAACATTAATGTAAGATTCCTCTTTAGTTTTTTTGTAACATTTGGAAGTTTTGACAG
                      ____________________________________________________________
consensus GTGTAACATTAATGTAAGATTCCTCTTTAGTTTTTTTGTAACATTTGGAAGTTTTGACAG
 
. : . : . : . : . : . :
rJMSF026D09+ CAACATTCTATGGAAGTT
rJMFF004N22+ CAACATTCTATGGAAGTTGTAACATTAATGTTTTCTGAAAACGGTAAAGAAAGGTCTCT
rJMFF035N21+ CAACATTCTATGGAAGTTGTAACATTAATGTTTTCTGAAAACGGTAAAGAAAGGTCTCTT
                      ____________________________________________________________
consensus CAACATTCTATGGAAGTTGTAACATTAATGTTTTCTGAAAACGGTAAAGAAAGGTCTCTT