Previous Contig 009875:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035N03Sequence473009875 (5)gb:AB015472_15125302e-15Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAE1.>gb:BT004613_16376753009875 (5)gb:AB032536_15187084e-24Nicotiana tabacum A15 mRNA for hypothetical protein, complete cds.
JMSF023I15Sequence665009875 (5)gb:AB015472_15125309e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAE1.>gb:BT004613_16376754009875 (5)gb:AB032536_15187082e-25Nicotiana tabacum A15 mRNA for hypothetical protein, complete cds.
JMSF033K20Sequence180019769601009875 (5)gb:AB032536_15187082e-08Nicotiana tabacum A15 mRNA for hypothetical protein, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035N03- GTTTCCTATTTCTTTCTCTATCAG
                      ____________________________________________________________
consensus GTTTCCTATTTCTTTCTCTATCAG
 
. : . : . : . : . : . :
JMFF035N03- TTATTTCGCAATTTTCTTCACAAATGGGCGCGAAGAAGAATCAGAAGGCCGAGAGCGGCG
                      ____________________________________________________________
consensus TTATTTCGCAATTTTCTTCACAAATGGGCGCGAAGAAGAATCAGAAGGCCGAGAGCGGCG
 
. : . : . : . : . : . :
JMFF035N03- AGCAGAAGAAGGCCGACGGCGGCAAGAAGGAAGGCGGCGGCGGCGGCGACAATGCTTCCG
JMSF023I15- CCG
                      ____________________________________________________________
consensus AGCAGAAGAAGGCCGACGGCGGCAAGAAGGAAGGCGGCGGCGGCGGCGACAATGCTTCCG
 
. : . : . : . : . : . :
JMFF035N03- TGGTTCTCAAGGCGGATTTGCATTGCGAGGGTTGTGTTTCCAAAATCGTCAAAACCATTC
JMSF023I15- TGGTTCTCAAGGCGGATTTGCATTGCGAGGGTTGTGTTTCCAAAATCGTCAAAACCATTC
                      ____________________________________________________________
consensus TGGTTCTCAAGGCGGATTTGCATTGCGAGGGTTGTGTTTCCAAAATCGTCAAAACCATTC
 
. : . : . : . : . : . :
JMFF035N03- GAGGCTGTGATGGTGTGGAGGATGTAAAGGTGGAGCTCGGCGCTAACAAGGTGACAGTTA
JMSF023I15- GAGGCTGTGATGGTGTGGAGGATGTAAAGGTGGAGCTCGGCGCTAACAAGGTGACAGTTA
                      ____________________________________________________________
consensus GAGGCTGTGATGGTGTGGAGGATGTAAAGGTGGAGCTCGGCGCTAACAAGGTGACAGTTA
 
. : . : . : . : . : . :
JMFF035N03- AGGGGAAGGTGGATCCGGCGGTGGTGAAGGAGAAAGTGGAGGCGAAGACGCACAAGCAAG
JMSF023I15- AGGGGAAGGTGGATCCGGCGGTGGTGAAGGAGAAAGTGGAGGCGAAGACGCACAAGCAAG
rJMSF023I15+ TCCGGCCGTGGTGAAGGAGAAAGTGGAGGCGAAGACGCACAAGCAAG
                      ____________________________________________________________
consensus AGGGGAAGGTGGATCCGGCGGTGGTGAAGGAGAAAGTGGAGGCGAAGACGCACAAGCAAG
 
. : . : . : . : . : . :
JMFF035N03- TGGTGGTGGTGTCGCCGCAGCCGGCCAACAAAGGCGGCGAGAAGGCGAAAGAAGGAGGAG
JMSF023I15- TGGTGGTGGTGTCGCCGCAGCCGGCCAACAAAGGCGGCGAGAAGGCGAAAGAAGGAGGAG
rJMSF023I15+ TGGTGGTGGTGTCGCCGCAGCCGGCCAACAAAGGCGGCGAGAAGGCGAAAGAAGGAGGAG
rJMFF035N03+ CCAACAAAGGCGGCGAGAAGGCGAAAGAAGGAGGAG
                      ____________________________________________________________
consensus TGGTGGTGGTGTCGCCGCAGCCGGCCAACAAAGGCGGCGAGAAGGCGAAAGAAGGAGGAG
 
. : . : . : . : . : . :
JMFF035N03- GCGAAAAGCAGCAACAGAAGAAGAAGANAGAGGACAAGAAGGGTGGGGATTCAAAGGAGG
JMSF023I15- GCGAAAAGCAGCAACAGAAGAAGAAGAAAGAGGACAAGAAGGGTGGGGATTCAAAGGAGG
rJMSF023I15+ GCGAAAAGCAGCAACAGAAGAAGAAGAAAGAGGACAAGAAGGGTGGGGATTCAAAGGAGG
rJMFF035N03+ GCGAAAAGCAGCANCAGAAGAAGAAGAAAGAGGACAAGAAGGGTGGGGATTCAAAGGAGG
                      ____________________________________________________________
consensus GCGAAAAGCAGCAACAGAAGAAGAAGAAAGAGGACAAGAAGGGTGGGGATTCAAAGGAGG
 
. : . : . : . : . : . :
JMFF035N03- AGGAGAGTAAGAAGGGAGAAGATGACAAG
JMSF023I15- AGGAGAGTAAGAAGGGAGAAGATGACAAGAAGAAGGCCAAGGAGAAAGAGCCGGCGGTGA
rJMSF023I15+ AGGAGAGTAAGAAGGGAGAAGATGACAAGAAGAAGGCCAAGGAGAAAGAGCCGGCGGTGA
rJMSF033K20+ GA
rJMFF035N03+ AGGAGAGTAAGAAGGGAGAAGATGACAAGAAGAAGGCCAAGGAGAAAGAGCCGGCGGTGA
                      ____________________________________________________________
consensus AGGAGAGTAAGAAGGGAGAAGATGACAAGAAGAAGGCCAAGGAGAAAGAGCCGGCGGTGA
 
. : . : . : . : . : . :
JMSF023I15- CGACGGCGGTGTTCAAGATGAATCTCCACTGCGAAGGTTGTATCCAGAAGATTTACAAGA
rJMSF023I15+ CGACGGCGGTGTTCAAGATGAATCTCCACTGCGAAGGTTGTATCCAGAAGATTTACAAGA
rJMSF033K20+ CGACGNCGGTGTTCAAGATGNATCTCCACTGCGAAGGTTNTATCCANAAGATTTCCTAGA
rJMFF035N03+ CGACGGCGGTGTTCAAGATGAATCTCCACTGCGAAGGTTGTATCCAGAAGATTTACAAGA
                      ____________________________________________________________
consensus CGACGGCGGTGTTCAAGATGAATCTCCACTGCGAAGGTTGTATCCAGAAGATTTACAAGA
 
. : . : . : . : . : . :
JMSF023I15- TCGTCAGCAAAACCAAAGGATATCACGAAATGAAACTGGACAGGCAGAAGGAGGTGGTGA
rJMSF023I15+ TCGTCAGCAAAACCAAAGGATATCACGAAATGAAACTGGACAGGCAGAAGGAGGTGGTGA
rJMSF033K20+ TCGTCAGCAAAACCAAAGGATATCANGAAATGAAACTGGACAGGCAGAAGGAGGTGGTGA
rJMFF035N03+ TCGTCAGCAAAACCAAAGGATATCACGAAATGAAACTGGACAGGCAGAAGGAGGTGGTGA
                      ____________________________________________________________
consensus TCGTCAGCAAAACCAAAGGATATCACGAAATGAAACTGGACAGGCAGAAGGAGGTGGTGA
 
. : . : . : . : . : . :
JMSF023I15- CGGTAACGGGAGCAATGGACATGA
rJMSF023I15+ CGGTAACGGGAGCAATGGACATGAAGGCGTTAGCGGAGAACCTGAAGAAGCACCTGAAAC
rJMSF033K20+ CGGTAACGNGANCAATGGACATGANGNCGTTAGNGGTGAACCTGNAGAAGCACCTGAANC
rJMFF035N03+ CGGTAACGGGAGCAATGGACATGAAGGCGTTAGCGGAGAACCTGAAGAAGCACCTGAAAC
                      ____________________________________________________________
consensus CGGTAACGGGAGCAATGGACATGAAGGCGTTAGCGGAGAACCTGAAGAAGCACCTGAAAC
 
. : . : . : . : . : . :
rJMSF023I15+ GGGACGTGGAGATCGTGCCGCCGAAGAAGGAAGGCGGCGGCGAGAAGAAGGAGAAGGGCG
rJMSF033K20+ GNGACGTGGAGNTCNTGNCGCCNAAGAAGGNAGGCGGCGGCGNGAAGAAGGAGAAGGGCG
rJMFF035N03+ GGGACGTGGAGATCGTGCCGCCGAAGAAGGAAGGCGGCGGCGAGAAGAAGGAGAAGGGCG
                      ____________________________________________________________
consensus GGGACGTGGAGATCGTGCCGCCGAAGAAGGAAGGCGGCGGCGAGAAGAAGGAGAAGGGCG
 
. : . : . : . : . : . :
rJMSF023I15+ GCGGGAATGAGAAGGGAAATGACAAGGGAAAGGGCGGCGGAAAGAAGGAAGCCGGTGGCG
rJMSF033K20+ GCGGGAATGAGAAGGGAAATGTCAAGNGAAAGGGCGGCGGAAAGAAGGAAGCCGGTGGCG
rJMFF035N03+ GCGGGAATGAGAAGGGAAATGACAAGGGAAAGGGCGGCGGAAAGAAGGAAGCCGGTGGCG
                      ____________________________________________________________
consensus GCGGGAATGAGAAGGGAAATGACAAGGGAAAGGGCGGCGGAAAGAAGGAAGCCGGTGGCG
 
. : . : . : . : . : . :
rJMSF023I15+ GTGGTGGTGGTGACGGCGGGGAGAAGAATAAAGAAGAGGCAGCAAACAAANTGCAAGTGC
rJMSF033K20+ GTGGTGGTGGTGACGGCGGGGAGAAGAATAAAGANGNGGCANCAAACAAAATGCAAGTGC
rJMFF035N03+ GTGGTGGTGGTGACGGCGGGGAGAAGAATAAAGAAGAGGCAGCAAACAAAATGCAAGTGC
                      ____________________________________________________________
consensus GTGGTGGTGGTGACGGCGGGGAGAAGAATAAAGAAGAGGCAGCAAACAAAATGCAAGTGC
 
. : . : . : . : . : . :
rJMSF023I15+ AAGTGGGGTACCCGTATCAGGGTCCGTACCCGTATATGTATGGGCCGGGTTATGTACAAG
rJMSF033K20+ AAGTGGGGTACCTGTATCAGGGTCCGTACCCGTATANGTATGGGCCGGGTTATGTACAAG
rJMFF035N03+ AAGTGGGGTACCCGTATCAGGGTCCGTACCCGTATATGTATGGGCCGGGTTATGTACAAG
                      ____________________________________________________________
consensus AAGTGGGGTACCCGTATCAGGGTCCGTACCCGTATATGTATGGGCCGGGTTATGTACAAG
 
. : . : . : . : . : . :
rJMSF023I15+ ACCAGATGTACTACAATTACCCTCATGCCCCTCA-GATGTTCAGTGACGAGAACCCTAAT
rJMSF033K20+ ACCAGATGTACTACAATTACCCTCATGCCCCTCACGATGTTCAGTGACGAGAACCNTAAT
rJMFF035N03+ ACCAGATGTACTACAATTACCCTCATGCCCCTCA-GATGTTCAGTGACGAGAACCCTAAT
                      ____________________________________________________________
consensus ACCAGATGTACTACAATTACCCTCATGCCCCTCA-GATGTTCAGTGACGAGAACCCTAAT
 
. : . : . : . : . : . :
rJMSF023I15+ GCTTGTAGCGTTATGTAATATGACA-CCACGGCATGTTCTAGAATGCGT
rJMSF033K20+ GCTTGTAGCGTTATNTAATATGACATCCACGNCATGTTCTAGAATGCGTTGTTAGCAGTT
rJMFF035N03+ GCTTGTAGCGTTATGTAATATGACA-CCACGGCATGTTCTAGAATGCGTTGTTA-CAGTT
                      ____________________________________________________________
consensus GCTTGTAGCGTTATGTAATATGACA-CCACGGCATGTTCTAGAATGCGTTGTTAGCAGTT
 
. : . : . : . : . : . :
rJMSF033K20+ GTAAATAAATTGCGTAGTAGCACACTTTTTGGTTTCTAAATTCTTAGT
rJMFF035N03+ GTAAATAAATTGCGTAGTAGCACACTTTTTGGTTTCTAAATTCTTAGTTAGCNGAAAAAA
                      ____________________________________________________________
consensus GTAAATAAATTGCGTAGTAGCACACTTTTTGGTTTCTAAATTCTTAGTTAGCNGAAAAAA