Previous Contig 009864:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035G21Sequence584004524 (3)gb:AP004562_18416235e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P047650009864 (4)pir|F86452|F864529e-40protein F6N18.17 [imported] - Arabidopsis thaliana>gb:AE005172_892114 Arabidopsi
JMFF039I12Sequence583004524 (3)pir|F86452|F864523e-07protein F6N18.17 [imported] - Arabidopsis thaliana>gb:AE005172_892114 Arabidopsi671009864 (4)pir|F86452|F864521e-45protein F6N18.17 [imported] - Arabidopsis thaliana>gb:AE005172_892114 Arabidopsi
JMFN030C09Sequence609009864 (4)pir|F86452|F864522e-33protein F6N18.17 [imported] - Arabidopsis thaliana>gb:AE005172_892114 Arabidopsi
JMSF003I02Sequence346004524 (3)763009864 (4)gb:AP004562_18416242e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003I02+ GATCATCAGGTCACTGAAGAGCAGCTTGCTGGACTCTTTCTCAACTGTGG
                      ____________________________________________________________
consensus GATCATCAGGTCACTGAAGAGCAGCTTGCTGGACTCTTTCTCAACTGTGG
 
. : . : . : . : . : . :
rJMSF003I02+ CCAGGTTGTTGACTGTCGAATATGTGGTGACCCCAACTCGGTGCTTCGCTTTGCTTTTGT
                      ____________________________________________________________
consensus CCAGGTTGTTGACTGTCGAATATGTGGTGACCCCAACTCGGTGCTTCGCTTTGCTTTTGT
 
. : . : . : . : . : . :
rJMSF003I02+ TGAATTTACTGATGAAGAAGGAGCAAGGAATGCTTTGAGTCTAGCAGGAACTATGCTTGG
                      ____________________________________________________________
consensus TGAATTTACTGATGAAGAAGGAGCAAGGAATGCTTTGAGTCTAGCAGGAACTATGCTTGG
 
. : . : . : . : . : . :
rJMSF003I02+ GTACTATCCAGTGAGGGTGCTTCCCTCTAAAACTGCTATTGCACCCGTTAATCCAACATT
rJMFF039I12+ CCAACATT
                      ____________________________________________________________
consensus GTACTATCCAGTGAGGGTGCTTCCCTCTAAAACTGCTATTGCACCCGTTAATCCAACATT
 
. : . : . : . : . : . :
rJMSF003I02+ TCTGCCACAGTCTGAAGATGAAAGGGAGATGTGTGCAAGAACTATATATTGTACAAACAT
rJMFF039I12+ TCTGCCACAGTCTGAAGATGAAAGGGAGATGTGTGCAAGAACTATATATTGTACAAACAT
JMFN030C09- TATATATTGTACAAACAT
rJMFF035G21+ GTCTGAAGATGAAAGGGAGATGTGTGCAAGAACTATATATTGTACAAACAT
                      ____________________________________________________________
consensus TCTGCCACAGTCTGAAGATGAAAGGGAGATGTGTGCAAGAACTATATATTGTACAAACAT
 
. : . : . : . : . : . :
rJMSF003I02+ TGATAAGAAGGTTACTCAAGCAGATGTCAAACTCTTTTTTGAAACCATTTGTGGAGAGGT
rJMFF039I12+ TGATAAGAAGGTTACTCAAGCAGATGTCAAACTCTTTTTTGAAACCATTTGTGGAGAGGT
JMFN030C09- TGATAAGAAGGTTACTCAAGCAGATGTCAAACTCTTTTTTGAAACCATTTGTGGAGAGGT
rJMFF035G21+ TGATAAGAAGGTTACTCAAGCAGATGTCAAACTCTTTTTTGAAACCATTTGTGGAGAGGT
                      ____________________________________________________________
consensus TGATAAGAAGGTTACTCAAGCAGATGTCAAACTCTTTTTTGAAACCATTTGTGGAGAGGT
 
. : . : . : . : . : . :
rJMSF003I02+ TCACCGTTTGCGGTTGCTTGGTGACTATCAGCATTCAACACGCATAGCATTTGTTGAGTT
rJMFF039I12+ TCACCGTTTGCGGTTGCTTGGTGACTATCAGCATTCAACACGCATAGCATTTGTTGAGTT
JMFN030C09- TCACCGTTTGCGGTTGCTTGGTGACTATCAGCATTCAACACGCATAGCATTTGTTGAGTT
rJMFF035G21+ TCACCGTTTGCGGTTGCTTGGTGACTATCAGCATTCAACACGCATAGCATTTGTTGAGTT
                      ____________________________________________________________
consensus TCACCGTTTGCGGTTGCTTGGTGACTATCAGCATTCAACACGCATAGCATTTGTTGAGTT
 
. : . : . : . : . : . :
rJMSF003I02+ TGTAATGGCTGAGAGTGCGATTGCTGCATTGAACTGCAGTGGTGTTATCTTGGGATCACT
rJMFF039I12+ TGTAATGGCTGAGAGTGCGATTGCTGCATTGAACTGCAGTGGTGTTATCTTGGGATCACT
JMFN030C09- TGTAATGGCTGAGAGTGCGATTGCTGCATTGAACTGCAGTGGTGTTATCTTGGGATCACT
rJMFF035G21+ TGTAATGGCTGAGAGTGCGATTGCTGCATTGAACTGCAGTGGTGTTATCTTGGGATCACT
                      ____________________________________________________________
consensus TGTAATGGCTGAGAGTGCGATTGCTGCATTGAACTGCAGTGGTGTTATCTTGGGATCACT
 
. : . : . : . : . : . :
rJMSF003I02+ TCCGATAAGGGTAAGTCCATCAAAGACTCCTGTTCGACCCCGTGCTCCACGCCCTGCTGT
rJMFF039I12+ TCCGATAAGGGTAAGTCCATCAAAGACTCCTGTTCGACCCCGTGCTCCACGCCCTGCTGT
JMFN030C09- TCCGATAAGGGTAAGTCCATCAAAGACTCCTGTTCGACCCCGTGCTCCACGCCCTGCTGT
rJMFF035G21+ TCCGATAAGGGTAAGTCCATCAAAGACTCCTGTTCGACCCCGTGCTCCACGCCCTGCTGT
                      ____________________________________________________________
consensus TCCGATAAGGGTAAGTCCATCAAAGACTCCTGTTCGACCCCGTGCTCCACGCCCTGCTGT
 
. : . : . : . : . : . :
rJMSF003I02+ GCTGCACTGATCTATCCTGTGCCACCGCCTTAAAGCTGTTCTTGTTCGTATTCTATTCTA
rJMFF039I12+ GCTGCACTGATCTATCCTGTGCCACCGCCTTAAAGCTGTTCTTGTTCGTATTCTATTCTA
JMFN030C09- GCTGCACTGATCTATCCTGTGCCACCGCCTTAAAGCTGTTCTTGTTCGTATTCTATTCTA
rJMFF035G21+ GCTGCACTGATCTATCCTGTGCCACCGCCTTAAAGCTGTTCTTGTTCGTATTCTATTCTA
                      ____________________________________________________________
consensus GCTGCACTGATCTATCCTGTGCCACCGCCTTAAAGCTGTTCTTGTTCGTATTCTATTCTA
 
. : . : . : . : . : . :
rJMSF003I02+ TACATATAGATGATACAGATACCTCCTCCATAGCGCTGTGCTTAGCCGAATCTATGAATT
rJMFF039I12+ TACATATAGATGATACAGATACCTCCTCCATAGCGCTGTGCTTAGCCGAATCTATGAATT
JMFN030C09- TACATATAGATGATACAGATACCTCCTCCATAGCGCTGTGCTTAGCCGAATCTATGAATT
rJMFF035G21+ TACATATAGATGATACAGATACCTCCTCCATAGCGCTGTGCTTAGCCGAATCTATGAATT
                      ____________________________________________________________
consensus TACATATAGATGATACAGATACCTCCTCCATAGCGCTGTGCTTAGCCGAATCTATGAATT
 
. : . : . : . : . : . :
rJMSF003I02+ AGGGTTTTGGTGTTGTCGGACCCGTCATGGTTTGGTATCTGCAACCAACGTTTTCTTTTG
rJMFF039I12+ AGGGTTTTGGTGTTGTCGGACCCGTCATGGTTTGGTATCTGCAACCAACGTTTTCTTTTG
JMFN030C09- AGGGTTTTGGTGTTGTCGGACCCGTCATGGTTTGGTATCTGCAACCAACGTTTTCTTTTG
rJMFF035G21+ AGGGTTTTGGTGTTGTCGGACCCGTCATGGTTTGGTATCTGCAACCAACGTTTTCTTTTG
                      ____________________________________________________________
consensus AGGGTTTTGGTGTTGTCGGACCCGTCATGGTTTGGTATCTGCAACCAACGTTTTCTTTTG
 
. : . : . : . : . : . :
rJMSF003I02+ TAGCTGTGTTAGATGTGCAACCAACGTTTTCTTTTGTAGCCTGTGTTAGATGT
rJMFF039I12+ TAGCTGTGTTAGATGTGCAACCAACGTTTTCTTTTGTAG-CTGTGTTAGATGTTGTAGAG
JMFN030C09- TAGCTGTGTTAGATGTGCAACCAACGTTTTCTTTTGTAG-CTGTGTTAGATGTTGTAGAG
rJMFF035G21+ TAGCTGTGTTAGATGTGCAACCAACGTTTTCTTTTGTAG-CTGTGTTAGATGTTGTAGAG
                      ____________________________________________________________
consensus TAGCTGTGTTAGATGTGCAACCAACGTTTTCTTTTGTAG-CTGTGTTAGATGTTGTAGAG
 
. : . : . : . : . : . :
rJMFF039I12+ AGTTGGATGGTGTATTACGAGAGGCGTAATTTGTGGTAATTTATGCTGCCTGCCAAGTAT
JMFN030C09- AGTTGGATGGTGTATTACGAGAGGCGTAATT--TGGTAATTTATGCTGCCTGCCAAGTAT
rJMFF035G21+ AGTTGGATGGTGTATTACGAGAGGCGTAATTTGTGGTAATTTATGCTGCCTGCCAAGTAT
                      ____________________________________________________________
consensus AGTTGGATGGTGTATTACGAGAGGCGTAATTTGTGGTAATTTATGCTGCCTGCCAAGTAT
 
. : . : . : . : . : . :
rJMFF039I12+ GTTCAATTCTGTAGGCTGTGCCTCAAAACTAATACTCGTACCATTTCATCAT
JMFN030C09- GTTCAATTCTGTANGCTGTGCCTNCAAACTAATACTCGTACCATTTCATCAT
rJMFF035G21+ GTTCAATTCTGTAGGCTGTGCCTCAAAACTAATACTCGTACCATTTCATCATGTTTCTAT
                      ____________________________________________________________
consensus GTTCAATTCTGTAGGCTGTGCCTCAAAACTAATACTCGTACCATTTCATCATGTTTCTAT