Previous Contig 009860:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022B23Sequence612009860 (15)sp|Q9FJP3|RK29_ARATH6e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi685009860 (15)sp|Q9FJP3|RK29_ARATH7e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMFF035E23Sequence611009860 (15)sp|Q9FJP3|RK29_ARATH6e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi704009860 (15)sp|Q9FJP3|RK29_ARATH8e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMFF040I23Sequence515009860 (15)sp|Q9FJP3|RK29_ARATH9e-3650S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi708009860 (15)sp|Q9FJP3|RK29_ARATH9e-3450S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMFN011C09Sequence630009860 (15)sp|Q9FJP3|RK29_ARATH2e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMFN014I04Sequence627009860 (15)sp|Q9FJP3|RK29_ARATH2e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMFN041A14Sequence656009860 (15)sp|Q9FJP3|RK29_ARATH2e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMSF002H21Sequence649009860 (15)sp|Q9FJP3|RK29_ARATH2e-3650S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMSF016B06Sequence347009860 (15)sp|Q9FJP3|RK29_ARATH1e-1150S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi724009860 (15)sp|Q9FJP3|RK29_ARATH7e-3750S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMSF021N14Sequence675019220gb:AY087176_15722102e-14Arabidopsis thaliana clone 32454 mRNA, complete sequence.674009860 (15)sp|Q9FJP3|RK29_ARATH2e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi
JMSF052I10Sequence665009860 (15)sp|Q9FJP3|RK29_ARATH2e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi683009860 (15)sp|Q9FJP3|RK29_ARATH3e-3850S ribosomal protein L29, chloroplast precursor.>gb:AB013395_1512169 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016B06- TGGAGCATTCATTAGTTTAAGAAACAAGAACTGGAAGATACTTGAGAGTAACTTAAT
                      ____________________________________________________________
consensus TGGAGCATTCATTAGTTTAAGAAACAAGAACTGGAAGATACTTGAGAGTAACTTAAT
 
. : . : . : . : . : . :
rJMSF016B06- AAGAGAATACAAGGAAGCAATACAATTGTGGTAACAGTTTGAGGAACAAAAGAGAATGCC
rJMFF040I23- CAAAAGAGAATGCC
                      ____________________________________________________________
consensus AAGAGAATACAAGGAAGCAATACAATTGTGGTAACAGTTTGAGGAACAAAAGAGAATGCC
 
. : . : . : . : . : . :
rJMSF016B06- TTAATCCAGATTGACAGAATATATTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
JMFN041A14+ AATCCAGATTGACAGAATATA-TTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
rJMFF040I23- TTAATCCAGATTGACAGAATATATTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
rJMSF052I10- TATTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
JMFN011C09+ GAACCACAATTAGCAGTGCAATGGGTAAATTGG
JMFN014I04+ GCAGTGCAATGGGTAAA-TGG
rJMSF021N14- TTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
rJMFF022B23- ATATTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
JMSF052I10+ GCAGTGCAATGGGTAAATTGG
rJMSF002H21- TATTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
rJMFF035E23- ATATTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
                      ____________________________________________________________
consensus TTAATCCAGATTGACAGAATATATTTGGAACCACAATTAGCAGTGCAATGGGTAAATTGG
 
. : . : . : . : . : . :
rJMSF016B06- AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
JMFN041A14+ AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
rJMFF040I23- AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
rJMSF052I10- AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
JMFN011C09+ AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
JMFN014I04+ AAANAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
rJMSF021N14- AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
rJMFF022B23- AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
JMSF052I10+ AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
rJMSF002H21- AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
JMFF035E23+ ATGAAGATGACATCATATTACCTACA
JMFF022B23+ ATGAAGATGACATCATATTACCTACA
rJMFF035E23- AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
                      ____________________________________________________________
consensus AAAAAACTAATACAACATACCTACACATAAACCAATGAAGATGACATCATATTACCTACA
 
. : . : . : . : . : . :
rJMSF016B06- TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
JMFN041A14+ TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
rJMFF040I23- TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
rJMSF052I10- TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
JMFN011C09+ TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
JMFN014I04+ TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
rJMSF021N14- TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
rJMFF022B23- TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
JMSF052I10+ TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
rJMSF002H21- TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
JMFF035E23+ TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
JMFF022B23+ TACAGAAAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
rJMFF035E23- TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
                      ____________________________________________________________
consensus TACAG-AAAGGTCTCTAAACTCAAGCAGATGACTTCTTAGCTTCTTCCTCTGCCTCCTCT
 
. : . : . : . : . : . :
rJMSF016B06- TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
JMFN041A14+ TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
rJMFF040I23- TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
rJMSF052I10- TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
JMFN011C09+ TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
JMFN014I04+ TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
rJMSF021N14- TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
rJMFF022B23- TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
JMSF052I10+ TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
rJMSF002H21- TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
JMFF035E23+ TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
JMFF022B23+ TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
JMFF040I23+ TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
rJMFF035E23- TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
                      ____________________________________________________________
consensus TGTAATTTCAATAAAGATGGAGGTGGTCTCGGAACAACGCTTTTCATCCACTTCTTGTCT
 
. : . : . : . : . : . :
rJMSF016B06- AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
JMFN041A14+ AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
rJMFF040I23- AGCTTCCTTGACAACCTCTTGTT-ATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
rJMSF052I10- AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
JMFN011C09+ AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
JMFN014I04+ AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
rJMSF021N14- AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
rJMFF022B23- AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
JMSF052I10+ AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
rJMSF002H21- AGCTTCCTTGACNACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
JMFF035E23+ AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
JMFF022B23+ AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
JMFF040I23+ AGCTTCCTTGACAACCTCTTGTT-ATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
rJMFF035E23- AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
                      ____________________________________________________________
consensus AGCTTCCTTGACAACCTCTTGTTAATTCCCTCCTCAAGCTCTCTCTCCCGTTTAACAGTC
 
. : . : . : . : . : . :
rJMSF016B06- ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
JMFN041A14+ ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
rJMFF040I23- ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
rJMSF052I10- ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGA
JMFN011C09+ ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
JMFN014I04+ ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
rJMSF021N14- ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
rJMFF022B23- ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
JMSF052I10+ ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGA
rJMSF002H21- ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
JMFF035E23+ ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
JMFF022B23+ ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
JMFF040I23+ ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
JMSF016B06+ GG
rJMFF035E23- ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
                      ____________________________________________________________
consensus ATCATTCGAGCAACCCGTTTACGCATCCGGCCGAACTCGCTGGACTTGAATTCATTGCGG
 
. : . : . : . : . : . :
rJMSF016B06- ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMFN041A14+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
rJMFF040I23- ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
rJMSF052I10- ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMFN011C09+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMFN014I04+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
rJMSF021N14- ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
rJMFF022B23- ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMSF052I10+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
rJMSF002H21- ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMFF035E23+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMFF022B23+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMFF040I23+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
JMSF016B06+ ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
rJMFF035E23- ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
                      ____________________________________________________________
consensus ACAGACGCCTGGAGGCGAAGCATTAACAGCTCTCCCTTGAGGTTCAATATCTCCTCGTTG
 
. : . : . : . : . : . :
rJMSF016B06- ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMFN041A14+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
rJMFF040I23- ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
rJMSF052I10- ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMFN011C09+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMFN014I04+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
rJMSF021N14- ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
rJMFF022B23- ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMSF052I10+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
rJMSF002H21- ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMFF035E23+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMFF022B23+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMFF040I23+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
JMSF016B06+ ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
rJMFF035E23- ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
                      ____________________________________________________________
consensus ATTTCGTCAGTAGTTTTCGCTCTGATTTCCTTCAATTCCTCTTCTTTCTTAGCCATTCGC
 
. : . : . : . : . : . :
rJMSF016B06- ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
JMFN041A14+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
rJMFF040I23- ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
rJMSF052I10- ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
JMFN011C09+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
JMFN014I04+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
rJMSF021N14- ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
rJMFF022B23- ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
JMSF052I10+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
rJMSF002H21- ACGACCAAAGAAGAAGAGGATGAATGCGATGCTCGAAGCGACGACGCAGGGCATACGTGG
JMFF035E23+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
JMFF022B23+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
JMFF040I23+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
JMSF016B06+ ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
rJMFF035E23- ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
                      ____________________________________________________________
consensus ACGACCAAAGAAGAAGAGGATGAATGCGATGTTCGAAGCGACGACGCAGGGCATACGTGG
 
. : . : . : . : . : . :
rJMSF016B06- GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMFN041A14+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
rJMFF040I23- GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
rJMSF052I10- GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMFN011C09+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMFN014I04+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
rJMSF021N14- GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
rJMFF022B23- GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMSF052I10+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
rJMSF002H21- GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMFF035E23+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMFF022B23+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMFF040I23+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
JMSF016B06+ GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
rJMFF035E23- GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
                      ____________________________________________________________
consensus GCAATCCGAACGCCGTGAAATAGGGATTTAGAGAGGTTCCTCGGCGGAGCAAAGGTCAGG
 
. : . : . : . : . : . :
rJMSF016B06- CTCG
JMFN041A14+ CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
rJMFF040I23- CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAANGGTAGTG
rJMSF052I10- CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
JMFN011C09+ CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAG
JMFN014I04+ CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
rJMSF021N14- CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
rJMFF022B23- CTCGGAGGCGACGCGACGGAGAGGCTCTTCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
JMSF052I10+ CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
rJMSF002H21- CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
JMFF035E23+ CTCGGAGGCGACGCGACGGAGAGGCTCTTCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
JMFF022B23+ CTCGGAGGCGACGCGACGGAGAGGCTCTTCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
JMFF040I23+ CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
JMSF016B06+ CTCGTAGGCGACGAGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
rJMFF035E23- CTCGGAGGCGACGCGACGGAGAGGCTCTTCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
                      ____________________________________________________________
consensus CTCGGAGGCGACGCGACGGAGAGGCTCATCATCTTTGCTGCTCTGAGGATAAGGGTAGTG
 
. : . : . : . : . : . :
rJMFF040I23- TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCAC
rJMSF052I10- TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACC
JMFN014I04+ TCAACTGT
rJMSF021N14- TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAA
rJMFF022B23- TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACCC
JMSF052I10+ TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACC
rJMSF002H21- TCAACTG
JMFF035E23+ TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACCC
JMFF022B23+ TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACCC
JMFF040I23+ TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCAC
JMSF016B06+ TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACC
rJMFF035E23- TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACCCCGGTTCTCGACGAA
                      ____________________________________________________________
consensus TCAACTGTTGAGTGTGGAAAAGTGCAGAAATGCCACAAAACCACCCCGGTTCTCGACGAA