Previous Contig 009859:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035E21Sequence602002021 (4)gb:AP003299_18276314e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P069291009859 (2)
JMSF044O05Sequence719002021 (4)411009859 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044O05+ TCAAACTCGTCGNGTGAGCTGCAAATTTT
                      ____________________________________________________________
consensus TCAAACTCGTCGNGTGAGCTGCAAATTTT
 
. : . : . : . : . : . :
rJMSF044O05+ GCCNGGCCNAGAAACCTTGGCTGGGNTTCAATCCAACTNCCNTTNTAGCAAGGNCTTGNC
                      ____________________________________________________________
consensus GCCNGGCCNAGAAACCTTGGCTGGGNTTCAATCCAACTNCCNTTNTAGCAAGGNCTTGNC
 
. : . : . : . : . : . :
rJMSF044O05+ CCTNGGATACNTGCAAAAGAAGNCCNACATNTGCNTCNTGGATTAAGATTTCNCTACCTA
                      ____________________________________________________________
consensus CCTNGGATACNTGCAAAAGAAGNCCNACATNTGCNTCNTGGATTAAGATTTCNCTACCTA
 
. : . : . : . : . : . :
rJMSF044O05+ AAGCNGCNGNGGGATCNTCNATAGGAAAAATGGGGTTTTNTCTTTCGTTTATTTGGNGAC
                      ____________________________________________________________
consensus AAGCNGCNGNGGGATCNTCNATAGGAAAAATGGGGTTTTNTCTTTCGTTTATTTGGNGAC
 
. : . : . : . : . : . :
rJMSF044O05+ TGAGGNGATCTGTCTTGATTTTAACTTTCNAGAAAGATATTTTTCNGNGTTTTGGTTGGN
rJMFF035E21+ TTGATTTTAACTTTCAAGAAANATATTTTTTTGNGTTTTGGGTGGG
                      ____________________________________________________________
consensus TGAGGNGATCTGTCTTGATTTTAACTTTCAAGAAAGATATTTTTTTGNGTTTTGGTTGGG
 
. : . : . : . : . : . :
rJMSF044O05+ GTTTTTTTTTG-TTTTTTTTTTTCTTTGTTTTATATTTGGAAGATGTATATTAATTTTAC
rJMFF035E21+ GNTTTTTTTTGTTTTTTTTTTTTCTTTGTTTTATATTTGGAAGATGTATATTAATTTTAC
                      ____________________________________________________________
consensus GTTTTTTTTTGTTTTTTTTTTTTCTTTGTTTTATATTTGGAAGATGTATATTAATTTTAC
 
. : . : . : . : . : . :
rJMSF044O05+ AGCTGGGTTTAAGAAGAAAAATTTAGCCCATATGACATGCCCAGCTACTCCAAATTGCTA
rJMFF035E21+ AGCTGGGTTTAAGAAGAAAAATTTAGCCCATATGACATGCCCAGCTACTCCAAATTGCTA
                      ____________________________________________________________
consensus AGCTGGGTTTAAGAAGAAAAATTTAGCCCATATGACATGCCCAGCTACTCCAAATTGCTA
 
. : . : . : . : . : . :
rJMSF044O05+ TAGATGTTAAAACCAATGATCTT
rJMFF035E21+ TAGATGTTAAAA-CAATGATCTTTTATCTTTAATCTATGTATTAATGTGAATAGAACATC
                      ____________________________________________________________
consensus TAGATGTTAAAACCAATGATCTTTTATCTTTAATCTATGTATTAATGTGAATAGAACATC
 
. : . : . : . : . : . :
rJMFF035E21+ AATGGATTGTCAATCAAATTTTATGTATTTCATATACTATTCTTCAAAACAAATTAATAA
                      ____________________________________________________________
consensus AATGGATTGTCAATCAAATTTTATGTATTTCATATACTATTCTTCAAAACAAATTAATAA