Previous Contig 009852:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H14Sequence534009852 (10)gb:AY395689_16048174e-71Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.760009852 (10)gb:AY395689_16048175e-78Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.
JMFF020J09Sequence533009852 (10)gb:AY395689_16048171e-70Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.738009852 (10)gb:AY395689_16048172e-77Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.
JMFF035D10Sequence370009852 (10)gb:AY395689_16048173e-44Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.641009852 (10)gb:AY395689_16048177e-43Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.
JMFF041H11Sequence648009852 (10)gb:AY395689_16048173e-87Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.631009852 (10)gb:AY395689_16048174e-63Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.
JMSF023C20Sequence725006127 (5)gb:AY088284_15733041e-67Arabidopsis thaliana clone 5176 mRNA, complete sequence.147009852 (10)sp|P41127|RL13_ARATH4e-1060S ribosomal protein L13 (BBC1 protein homolog).>pir|S37271|S37271 ribosomal pr
JMSF027C12Sequence682001663 (23)sp|Q9ATF5|RL1X_CASSA5e-8860S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei728009852 (10)gb:AY395689_16048172e-77Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035D10- NNTGCTGCCGAGCAACAAAGCCGAAAGCTCCTTTACCTGTTTCTAGG
JMFF002H14- AGCAACAAAGCCGAAAGCTCCTTTACCTGTTTCTAGG
JMFF041H11- AGCAACAAAGCCGAAAGCTCCTTTACCTGTTTCTAGG
rJMFF002H14+ AGG
                      ____________________________________________________________
consensus NNTGCTGCCGAGCAACAAAGCCGAAAGCTCCTTTACCTGTTTCTAGG
 
. : . : . : . : . : . :
JMFF035D10- TGAGTAATGAAACATAACAATGTTGTGCCCAGTGGGCACTTCAGGAAG-CACTGGCAGAA
JMFF020J09- ATGAAACATAACAATGTTGTGCCCAGTGGGCACTTCAGGAAG-CACTGGCAGAA
JMFF002H14- TGAGTAATGAAACATAACAATGTTGTGCCCAGTGGGCACTTCAGGAAG-CACTGGCAGAA
JMFF041H11- TGAGTAATGAAACATAACAATGTTGTGCCCAGTGGGCACTTCAGGAAG-CACTGGCAGAA
rJMFF002H14+ TGAGTAATGAAACATAACAATGTTGTGCCCAGTGGGCACTTCAGGAAGCCACTGGCAGAA
rJMSF027C12+ CAGGAAG-CACTGGCAGAA
rJMFF020J09+ TCAGGAAG-CACTGGCAGAA
                      ____________________________________________________________
consensus TGAGTAATGAAACATAACAATGTTGTGCCCAGTGGGCACTTCAGGAAG-CACTGGCAGAA
 
. : . : . : . : . : . :
JMFF035D10- CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAAACAAAGGAGGAGAGCTGCTAGACA
JMFF020J09- CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAAACAAAGGAGGAGAGCTGCTAGACA
JMFF002H14- CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAAACAAAGGAGGAGAGCTGCTAGACA
JMFF041H11- CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAAACAAAGGAGGAGAGCTGCTAGACA
rJMFF002H14+ CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAAACAAAGGAGGAGAGCTGCTAGACA
rJMSF027C12+ CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAAACAAAGGAGGAGAGCTGCTAGACA
rJMFF020J09+ CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAANCAAAGGAGGAGAGCTGCTAGACA
                      ____________________________________________________________
consensus CTATGTGAAGACATGGTTCAACCAACCTGCTCGCAAACAAAGGAGGAGAGCTGCTAGACA
 
. : . : . : . : . : . :
JMFF035D10- AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
JMFF020J09- AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
JMFF002H14- AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
JMFF041H11- AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
rJMFF002H14+ AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
rJMSF027C12+ AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
rJMFF020J09+ AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
rJMFF041H11+ ACTGCTGGAGCCCTTCGCCCAATTGTCCA
                      ____________________________________________________________
consensus AAAAAAGGCTGTTAAGATTTTCCCCAGGCCAACTGCTGGAGCCCTTCGCCCAATTGTCCA
 
. : . : . : . : . : . :
JMFF035D10- TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
JMFF020J09- TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
JMFF002H14- TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
JMFF041H11- TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
rJMFF002H14+ TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
rJMSF027C12+ TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
rJMFF020J09+ TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
rJMFF041H11+ TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
                      ____________________________________________________________
consensus TGGGCAGACACTCAAGTACAACATGAAAGTCAGGGCTGGTAGGGGATTCTCCCTCGAGGA
 
. : . : . : . : . : . :
JMFF035D10- GCTTAAGGCTGCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
JMFF020J09- GCTTAAGGCTGCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
JMFF002H14- GCTTAAGGCTGCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
JMFF041H11- GCTTAAGGCTCCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
rJMFF002H14+ GCTTAAGGCTGCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
rJMSF027C12+ GCTTAAGGCTGCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
rJMFF020J09+ GCTTAAGGCTGCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
rJMFF041H11+ GCTTAAGGCTCCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
rJMFF035D10+ ACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
                      ____________________________________________________________
consensus GCTTAAGGCTGCAGGTATCACAAAGAAACTGGCACCTACAATTGGCATCTCAGTTGATCA
 
. : . : . : . : . : . :
JMFF035D10- CCGCCGTAGGAACAGTTCGCTTGA
JMFF020J09- CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
JMFF002H14- CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
JMFF041H11- CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
rJMFF002H14+ CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
rJMSF027C12+ CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
rJMFF020J09+ CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
rJMFF041H11+ CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
rJMFF035D10+ CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGNTAATGTTCAGAGGCTGAAGACTTA
                      ____________________________________________________________
consensus CCGCCGTAGGAACAGTTCGCTTGAGGGTCTTCAGGCTAATGTTCAGAGGCTGAAGACTTA
 
. : . : . : . : . : . :
JMFF020J09- CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
JMFF002H14- CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
JMFF041H11- CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
rJMFF002H14+ CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
rJMSF027C12+ CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
rJMFF020J09+ CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
rJMFF041H11+ CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
rJMFF035D10+ CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTNTAC
                      ____________________________________________________________
consensus CAAGGCCAAATTGGTTGTCTTCCCAAGACGTGCTCGCAAATTTAAGGCTGGTGATTCTAC
 
. : . : . : . : . : . :
JMFF020J09- TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
JMFF002H14- TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
rJMSF023C20+ TCAATGGTCCTTACCTCCCTNTTNTACGTGA
JMFF041H11- TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
rJMFF002H14+ TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
rJMSF027C12+ TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
rJMFF020J09+ TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
rJMFF041H11+ TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
rJMFF035D10+ TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTNTACGTGA
                      ____________________________________________________________
consensus TCCCGAGGAATTGGCCACTGCAACCCAAGTCAATGGTCCTTACCTCCCTATTCTACGTGA
 
. : . : . : . : . : . :
JMFF020J09- GA
JMFF002H14- GAAGGCTTCAGTGG
rJMSF023C20+ GAAGGCTTCAGTGGAGTTTGTTANGGTCNCAGANGACATGAAGTCNTTCAAGGCATATGA
JMFF041H11- GAAGGCTTCAGTGGAGTTTGTTAAGGTCACAGACGACATGAAGTCATTCAAGGCATATGA
rJMFF002H14+ GAAGGCTTCAGTGGAGTTTGTTAAGGTCACAGACGACATGAAGTCATTCAAGGCATATGA
rJMSF027C12+ GAAGGCTTCAGTGGAGTTTGTTAAGGTCACAGACGACATGAAGTCATTCAAGGCATATGA
rJMFF020J09+ GAAGGCTTCAGTGGAGTTTGTTAAGGTCACAGACGACATGAAGTCATTCAAGGCATATGA
rJMFF041H11+ GAAGGCTTCAGTGGAGTTTGTTAAGGTCACAGACGACATGAAGTCATTCAAGGCATATGA
rJMFF035D10+ GAAGGCTTCAGTGGAGTTTGTTAAGGTCACAGACGACATGAAGTCATTCAAGGCATATGA
                      ____________________________________________________________
consensus GAAGGCTTCAGTGGAGTTTGTTAAGGTCACAGACGACATGAAGTCATTCAAGGCATATGA
 
. : . : . : . : . : . :
rJMSF023C20+ CNAGNTGCGTCTTGAACGGACGAATGAGCGCCATNTCGGTGCCAGGGCAAAGAGGG
JMFF041H11- CAAGCTGCGTCTTGAACGGACGAATGAGCGCCATATCGGTGCCAGGGCAAAGAGGGCTGC
rJMFF002H14+ CAAGCTGCGTCTTGAACGGACGAATGAGCGCCATATCGGTGCCAGGGCAAATAGGGCTGC
rJMSF027C12+ CAAGCTGCGTCTTGAACGGACGAATGAGCGCCATATCGGTGCCAGGGCAAAGAGGGCTGC
rJMFF020J09+ CAAGCTGCGTCTTGAACGGACGAATGAGCGCCATATCGGTGCCAGGGCAAAGAGGGCTGC
rJMFF041H11+ CAAGCTGCGTCTTGAACGGACGAATGAGCGCCATATCGGTGCCAGGGCAAAGAGGGCTGC
rJMFF035D10+ CAAGCTGCGTCTTGAACGGACGAATGAGCGCCATATCGGTGCCAGGGCAAAGAGGGCTGC
                      ____________________________________________________________
consensus CAAGCTGCGTCTTGAACGGACGAATGAGCGCCATATCGGTGCCAGGGCAAAGAGGGCTGC
 
. : . : . : . : . : . :
JMFF041H11- TGAGGCTG
rJMFF002H14+ TGAGGCTGAGAAGGAGGACAAAAAATAGTGTCCAACCTCTTCACTGCGCAAGCTAAATGA
rJMSF027C12+ TGAGGCTGAGAAGGAGGACAAAAAATAGTGTCCAACCTCTTCACTGCGCAAGCTAAATGA
rJMFF020J09+ TGAGGCTGAGAAGGAGGACAAAAAATAGTGTCCAACCTCTTCACTGCGCAAGCTAAATGA
rJMFF041H11+ TGAGGCTGAGAAGGAGGACAAAAAATAGTGTCCAACCTCTTCACTGCGCAAGCTAAATGA
rJMFF035D10+ TGAGGCTGAGAAGGAGGACAAAAAATAGTGTCCAACCTCTTCACTGCGCAAGCTAAATGA
                      ____________________________________________________________
consensus TGAGGCTGAGAAGGAGGACAAAAAATAGTGTCCAACCTCTTCACTGCGCAAGCTAAATGA
 
. : . : . : . : . : . :
rJMFF002H14+ GTCACTGCTCTTTTTCTTCTGAATCATCAATATTAGCAATTATACTATTGATTGTGTATG
rJMSF027C12+ GTCACTGCTCTTTTTCTTCTGAATCATCAATATTAGCAATTATACTATTGATTGTGTATG
rJMFF020J09+ GTCACTGCTCTTTTTCTTCTGAATCATCAATATTAGCAATTATACTATTGATTGTGTATG
rJMFF041H11+ GTCACTGCTCTTTTTCTTCTGAATCATCAATATTAGCAATTATACTATTGATTGTGTATG
rJMFF035D10+ GTCACTGCTCTTTTTCTTCTGAATCATCAATATTAGCAATTATACTATTGATTGTGTATG
                      ____________________________________________________________
consensus GTCACTGCTCTTTTTCTTCTGAATCATCAATATTAGCAATTATACTATTGATTGTGTATG
 
. : . : . : . : . : . :
rJMFF002H14+ AACTTCAAGATTTTCAACATTTATGGATTTGGATACC
rJMSF027C12+ AACTTCAAGATTTTCAACATTTATGGATTTGGATACCTGTCTATGAAATG
rJMFF020J09+ AACTTCAAGATTTTCAACATTTATGGATTTGGATACCTGTCTATGAAATGTGTTTTCAT
rJMFF041H11+ AACTTCAAGATTTTCAACATTTATGGATTTGGATACCTGTCTATGAAATGTGTTTTCAT
rJMFF035D10+ AACTTCAAGATTTTCAACATTTATGGATTTGGATACCTGTCTATGAAATGTGTTTTCATA
                      ____________________________________________________________
consensus AACTTCAAGATTTTCAACATTTATGGATTTGGATACCTGTCTATGAAATGTGTTTTCATA
 
. : . : . : . : . : . :
rJMFF035D10+ ATATTCATGGGTGTTNTACTCTCTTGATCCATGTCAGTCTCAGTTAGCAATTTTAGTCAG
                      ____________________________________________________________
consensus ATATTCATGGGTGTTNTACTCTCTTGATCCATGTCAGTCTCAGTTAGCAATTTTAGTCAG
 
. : . : . : . : . : . :
rJMFF035D10+ TATATATGTTTTTTTTTGTTTGATTCTTTAACACTCTTGTTGGATCTTCTGACCTCAATA
                      ____________________________________________________________
consensus TATATATGTTTTTTTTTGTTTGATTCTTTAACACTCTTGTTGGATCTTCTGACCTCAATA