Previous Contig 009849:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035D05Sequence539001560 (2)gb:HSU63332_20253719e-07Human super cysteine rich protein mRNA, partial cds.707009849 (2)pir|T46027|T46027e-104hypothetical protein T10K17.260 - Arabidopsis thaliana>gb:ATT10K17_1554272 Arabi
JMFS143F02Sequence619009849 (2)pir|T46027|T460271e-47hypothetical protein T10K17.260 - Arabidopsis thaliana>gb:ATT10K17_1554272 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS143F02+ TCATCGAAGCAAGATGTCAATTCCTCCTTTACAATGTCAGAATGATTTTGGTTCA
                      ____________________________________________________________
consensus TCATCGAAGCAAGATGTCAATTCCTCCTTTACAATGTCAGAATGATTTTGGTTCA
 
. : . : . : . : . : . :
JMFS143F02+ AGTCAGAACTTTTCTTCTCTCTATCCTTCTCCTTCTCTCTTAATCTTTCCTTCCTTCGAA
                      ____________________________________________________________
consensus AGTCAGAACTTTTCTTCTCTCTATCCTTCTCCTTCTCTCTTAATCTTTCCTTCCTTCGAA
 
. : . : . : . : . : . :
JMFS143F02+ GCTTTTTCTCCTTTTCCTTTATTCTCCTTCGCTCTTTGCGCTCTTCTTCTTCACGTTTTT
                      ____________________________________________________________
consensus GCTTTTTCTCCTTTTCCTTTATTCTCCTTCGCTCTTTGCGCTCTTCTTCTTCACGTTTTT
 
. : . : . : . : . : . :
JMFS143F02+ CCTTCTCTTCTTCTTCAAGAAGTTTCATCTGTTTCTCTAAAGTGATAATATCCTTGCATG
                      ____________________________________________________________
consensus CCTTCTCTTCTTCTTCAAGAAGTTTCATCTGTTTCTCTAAAGTGATAATATCCTTGCATG
 
. : . : . : . : . : . :
JMFS143F02+ CCACATGAACCTTTTCTTCCAGTAATTTTAATGCAAGACATACAAATATACTATGCGCAT
                      ____________________________________________________________
consensus CCACATGAACCTTTTCTTCCAGTAATTTTAATGCAAGACATACAAATATACTATGCGCAT
 
. : . : . : . : . : . :
JMFS143F02+ TTTGGCGTGCTGTTCCTTCTCTGAAAGCTTTTTCAACCTGTTCCTTGAAAATTACAGTTG
                      ____________________________________________________________
consensus TTTGGCGTGCTGTTCCTTCTCTGAAAGCTTTTTCAACCTGTTCCTTGAAAATTACAGTTG
 
. : . : . : . : . : . :
JMFS143F02+ CAGCATCAAGAAGAAACTCCCGAGCAAGTTCAGGACTCTTTGCATGTTTTTGAGGACGGG
                      ____________________________________________________________
consensus CAGCATCAAGAAGAAACTCCCGAGCAAGTTCAGGACTCTTTGCATGTTTTTGAGGACGGG
 
. : . : . : . : . : . :
JMFS143F02+ TACATTCACCATCGAGATCACTTCCATCTTTATCCATGGAATCATCATCCTCTTCTTCCT
                      ____________________________________________________________
consensus TACATTCACCATCGAGATCACTTCCATCTTTATCCATGGAATCATCATCCTCTTCTTCCT
 
. : . : . : . : . : . :
JMFS143F02+ CAGCCTCTTCAGCATGCTCAAAAAACCTTCTGATGTTTTCCCCTCTTGTAATTGTAACAA
                      ____________________________________________________________
consensus CAGCCTCTTCAGCATGCTCAAAAAACCTTCTGATGTTTTCCCCTCTTGTAATTGTAACAA
 
. : . : . : . : . : . :
JMFS143F02+ AACCATCTCCAACCATAAGCCTACAATGAATGCATTGTTGCCCTTTCATAGAGTGAGCCT
rJMFF035D05- CATAAGCCTACAATGAATGCATTGTTGCCCTTTCATAGAGTGAGCCT
                      ____________________________________________________________
consensus AACCATCTCCAACCATAAGCCTACAATGAATGCATTGTTGCCCTTTCATAGAGTGAGCCT
 
. : . : . : . : . : . :
JMFS143F02+ TCACAGAGAGCTCAGAGCAACGGC
rJMFF035D05- TCACAGAGAGCTCAGAGCAACGGCCATCCATTTTCCATGCCCTAAGAGTAATGTAGCACG
                      ____________________________________________________________
consensus TCACAGAGAGCTCAGAGCAACGGCCATCCATTTTCCATGCCCTAAGAGTAATGTAGCACG
 
. : . : . : . : . : . :
rJMFF035D05- CACTCAAGCCACTGAGGTCTAGACCATTCACTTGAACTCTTCCACTCAAACCAACATTTT
                      ____________________________________________________________
consensus CACTCAAGCCACTGAGGTCTAGACCATTCACTTGAACTCTTCCACTCAAACCAACATTTT
 
. : . : . : . : . : . :
rJMFF035D05- CAAACTCCAAGATATCGGATTTTCCTTCTCCAGTTCCAACTGCCCATTCAAAATGATGAT
                      ____________________________________________________________
consensus CAAACTCCAAGATATCGGATTTTCCTTCTCCAGTTCCAACTGCCCATTCAAAATGATGAT
 
. : . : . : . : . : . :
rJMFF035D05- ATGTCCCAAAAGTGTCAATGAAAGTGTGATGCCAATCTACTTGGATTGTATCACGGGAAA
                      ____________________________________________________________
consensus ATGTCCCAAAAGTGTCAATGAAAGTGTGATGCCAATCTACTTGGATTGTATCACGGGAAA
 
. : . : . : . : . : . :
rJMFF035D05- CCTCATATTGAAATGCTGTATCTGCTACACAAAACCAACTGGTGCAGCGAGGTTCTCTCC
                      ____________________________________________________________
consensus CCTCATATTGAAATGCTGTATCTGCTACACAAAACCAACTGGTGCAGCGAGGTTCTCTCC
 
. : . : . : . : . : . :
rJMFF035D05- TCATCCGCTTCAGTTCCTTTAGCTCCTTGAACTCACGTATAACATTCCTTCTGCAATCTC
                      ____________________________________________________________
consensus TCATCCGCTTCAGTTCCTTTAGCTCCTTGAACTCACGTATAACATTCCTTCTGCAATCTC
 
. : . : . : . : . : . :
rJMFF035D05- TACAAAACCTCTTGCTATCAAATCTGTACATAAGCCTTTCAATAAAGTCCTCTTCCTTCA
                      ____________________________________________________________
consensus TACAAAACCTCTTGCTATCAAATCTGTACATAAGCCTTTCAATAAAGTCCTCTTCCTTCA
 
. : . : . : . : . : . :
rJMFF035D05- TTCTTAGAAGAGACTGGCGAGTCTCTTCTCCAAGGGCTGACCAAAAATCTACCAATGTGT
                      ____________________________________________________________
consensus TTCTTAGAAGAGACTGGCGAGTCTCTTCTCCAAGGGCTGACCAAAAATCTACCAATGTGT
 
. : . : . : . : . : . :
rJMFF035D05- CAACAGAAAGTCTGGCAGTGTGAAGAGCACATGTTTCTCTCGTTCCATGACCTCTTCCAT
                      ____________________________________________________________
consensus CAACAGAAAGTCTGGCAGTGTGAAGAGCACATGTTTCTCTCGTTCCATGACCTCTTCCAT
 
. : . : . : . : . : . :
rJMFF035D05- AACCAACCATTCCTTGACTTATCCAACCTCTACCACCTCCACCGCAGGCATCAGGATACA
                      ____________________________________________________________
consensus AACCAACCATTCCTTGACTTATCCAACCTCTACCACCTCCACCGCAGGCATCAGGATACA
 
. : . : . : . : . : . :
rJMFF035D05- GCAATTCCCTCTCGCGTTCTCTTGCACGTGCACTGTCGAAAACATTTTGGAGTCCTTTCA
                      ____________________________________________________________
consensus GCAATTCCCTCTCGCGTTCTCTTGCACGTGCACTGTCGAAAACATTTTGGAGTCCTTTCA