Previous Contig 009839:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C16Sequence253014091gb:AY321293_15991181e-04Lycopersicon esculentum glycine-rich protein TomR2 (TomR2) gene, complete cds.301009839 (5)
JMFF007J10Sequence634009839 (5)gb:AP004683_18433117e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P000792009839 (5)gb:AP004683_18433117e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P000
JMFF034N22Sequence570009839 (5)gb:AP004683_18433111e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P000665009839 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF034N22- CTACAATCGACTCCCCGTCCGGTTCTACCCACGCCGCGCTTCCTAGAGCTCGCCGGC
JMFF007J10- GTCTACAATCGACTCCCCGTCCGGTTCTACCCACGCCGCGCTTCCTAGAGCTCGCCGGC
                      ____________________________________________________________
consensus GTCTACAATCGACTCCCCGTCCGGTTCTACCCACGCCGCGCTTCCTAGAGCTCGCCGGC
 
. : . : . : . : . : . :
JMFF034N22- GACGAGTCAGCCTCCCCAGTCGCACCAGTCAGCCTCCGTCCGTCGCATCAGTCAGCCTCC
JMFF007J10- GACGAGTCAGCCTCCCCAGTCGCACCAGTCAGCCTCCGTCCGTCGCATCAGTCAGCCTCC
                      ____________________________________________________________
consensus GACGAGTCAGCCTCCCCAGTCGCACCAGTCAGCCTCCGTCCGTCGCATCAGTCAGCCTCC
 
. : . : . : . : . : . :
JMFF034N22- GTCCGTCGCATCAGTCAGCCATCGCCGACGCAGACTCGCCGGCAGAGCTCATCGCAAACG
JMFF007J10- GTCCGTCGCATCAGTCAGCCATCGCCGACGCAGACTCGCCGGCAGAGCTCATCGCAAACG
                      ____________________________________________________________
consensus GTCCGTCGCATCAGTCAGCCATCGCCGACGCAGACTCGCCGGCAGAGCTCATCGCAAACG
 
. : . : . : . : . : . :
JMFF034N22- GCAGCGGCAGTCATCGAGCTTCTCCGACCTCCAGCAAACACCCACAAACGACCCTCCTCT
JMFF007J10- GCAGCGGCAGTCATCGAGCTTCTCCGACCTCCAGCAAACACCCACAAACGACCCTCCTCT
                      ____________________________________________________________
consensus GCAGCGGCAGTCATCGAGCTTCTCCGACCTCCAGCAAACACCCACAAACGACCCTCCTCT
 
. : . : . : . : . : . :
JMFF034N22- GCCGAGTGCCTAAGCTCCTACACCAATGAAGCGTCCTAGGCAACAGGCTTAAACCTTAAA
JMFF007J10- GCCGAGTGCCTAAGCTCCTACACCAATGAAGCGTCCTAGGCAACAGGCTTAAACCTTAAA
                      ____________________________________________________________
consensus GCCGAGTGCCTAAGCTCCTACACCAATGAAGCGTCCTAGGCAACAGGCTTAAACCTTAAA
 
. : . : . : . : . : . :
JMFF034N22- GAAGTTGCAACAAAATGACACCGCGGTCCTAGAGAAAGACGGTAAGAGAATTGGCTAGAT
JMFF007J10- GAAGTTGCAACAAAATGACACCGCGGTCCTAGAGAAAGACGGTAAGAGAATTGGCTAGAT
                      ____________________________________________________________
consensus GAAGTTGCAACAAAATGACACCGCGGTCCTAGAGAAAGACGGTAAGAGAATTGGCTAGAT
 
. : . : . : . : . : . :
JMFF034N22- CGGCTCTTGGTCTACTAGAAGCTTCTTCTTCCTTGGGTCTTACATCCCAAACCATCGCCT
JMFF007J10- CGGCTCTTGGTCTACTAGAAGCTTCTTCTTCCTTGGGTCTTACATCCCAAACCATCGCCT
                      ____________________________________________________________
consensus CGGCTCTTGGTCTACTAGAAGCTTCTTCTTCCTTGGGTCTTACATCCCAAACCATCGCCT
 
. : . : . : . : . : . :
JMFF034N22- ATTAACGATTTGCCAAGGGATTATTCCGGCATCCCATTGAGTTCTCGAGGTTCATCACCA
JMFF007J10- ATTAACGATTTGCCAAGGGATTATTCCGGCATCCCATTGAGTTCTCGAGGTTCATCACCA
rJMFF007J10+ GAGGTTCATCACCA
                      ____________________________________________________________
consensus ATTAACGATTTGCCAAGGGATTATTCCGGCATCCCATTGAGTTCTCGAGGTTCATCACCA
 
. : . : . : . : . : . :
JMFF034N22- AAATGCCTCGGTACTATTGTGACTACTGCGATACTTACTTGACTCATGATTCCCCTTCAG
JMFF007J10- AAATGCCTCGGTACTATTGTGACTACTGCGATACTTACTTGACTCATGATTCCCCTTCAG
rJMFF007J10+ AAATGCCTCGGTACTATTGTGACTACTGCGATACTTACTTGACTCATGATTCCCNTTCAG
                      ____________________________________________________________
consensus AAATGCCTCGGTACTATTGTGACTACTGCGATACTTACTTGACTCATGATTCCCCTTCAG
 
. : . : . : . : . : . :
JMFF034N22- TCAGAAAACAGCATAATGCTGGCTACAAACA
JMFF007J10- TCAGAAAACAGCATAATGCTGGCTACAAACATAAGGCAAATGTACGATCTTATTATCTAA
rJMFF007J10+ TCAGAAAACAGCATAATGCTGGCTACAAACATAAGGCAAATGTACGATCTTATTATCTAA
rJMFF034N22+ TCTAA
                      ____________________________________________________________
consensus TCAGAAAACAGCATAATGCTGGCTACAAACATAAGGCAAATGTACGATCTTATTATCTAA
 
. : . : . : . : . : . :
JMFF007J10- AGTTTGAAGAACAGCAAACACAGGCTTTGATAGAT
rJMFF007J10+ AGTTTGAAGAACAGCAAACACAGGCTTTGATAGATCAAAGGATTAAAGAGCGTCTTGGGC
rJMFF034N22+ AGTTTGAAGAACAGCAAACACAGGCTTTGATAGATCAAAGGATTAAAGAGCGTCTTGGGC
                      ____________________________________________________________
consensus AGTTTGAAGAACAGCAAACACAGGCTTTGATAGATCAAAGGATTAAAGAGCGTCTTGGGC
 
. : . : . : . : . : . :
rJMFF007J10+ AGGCAGCAGCATACCAACAAATTGGTGCCGCATATAACCAACATCTTGCTGCTTTCCCTG
rJMFF034N22+ AGGCAGCAGCATACCAACAAATTGGTGCCGCATATAACCAACATCTTGCTGCTTTCCCTG
                      ____________________________________________________________
consensus AGGCAGCAGCATACCAACAAATTGGTGCCGCATATAACCAACATCTTGCTGCTTTCCCTG
 
. : . : . : . : . : . :
rJMFF007J10+ GACAACCACCGCGTATGCCTATCTTGCCACCTCCTTTTCTGCCTATTCCTGGAGCTCCGC
rJMFF034N22+ GACAACCACCGCGTATGCCTATCTTGCCACCTCCTTTTCTGCCTATTCCTGGAGCTCCGC
                      ____________________________________________________________
consensus GACAACCACCGCGTATGCCTATCTTGCCACCTCCTTTTCTGCCTATTCCTGGAGCTCCGC
 
. : . : . : . : . : . :
rJMFF007J10+ CTCCACAGTTAGTCCCAGGAGTAAGGCCTCCCATATTTCCTAGACCTCTTCCAGGTGCTC
rJMFF034N22+ CTCCACAGTTAGTCCCAGGAGTAAGGCCTCCCATATTTCCTAGACCTNTTCCAGGTGCTC
                      ____________________________________________________________
consensus CTCCACAGTTAGTCCCAGGAGTAAGGCCTCCCATATTTCCTAGACCTCTTCCAGGTGCTC
 
. : . : . : . : . : . :
rJMFF007J10+ CAGCTTATTATTCAGTACCTCCGGTTGCACCAGTTCCAGGACAACCCCCAGGTGGTGAAG
rJMFF034N22+ CAGCTTATTATTCAGTACCTCCGGTTGCACCAGTTCCAGGACAACCCCCAGGTGGTGAAG
                      ____________________________________________________________
consensus CAGCTTATTATTCAGTACCTCCGGTTGCACCAGTTCCAGGACAACCCCCAGGTGGTGAAG
 
. : . : . : . : . : . :
rJMFF003C16+ TGGAGGTGGTGGCG
rJMFF007J10+ GTGGCGGCGCAGGAGGCGGAGCACATGGAGGTGGGTACGCTGGTGGTGGAGGTGGTGGCG
rJMFF034N22+ GTGGCGGCGCAGGAGGCGGAGCACATGGAGGTGGGTACGCTGGTGGTGGAGGTGGTGGCG
                      ____________________________________________________________
consensus GTGGCGGCGCAGGAGGCGGAGCACATGGAGGTGGGTACGCTGGTGGTGGAGGTGGTGGCG
 
. : . : . : . : . : . :
rJMFF003C16+ GAGGATCAGGCGGAGGCGGCGGGGGAGGTGAACATGGAGGTGGATATGGCGGCGGTGCCG
rJMFF007J10+ GAGGATCAGGCGGAGGCGGCGGGGGAGGTGAACATGGAGGTGGATATGGCGGCGGTGCCG
rJMFF034N22+ GAGGATCAGGCGGAGGCGGCGGGGGAGGTGAACATGGAGGTGGATATGGCGGCGGTGCCG
                      ____________________________________________________________
consensus GAGGATCAGGCGGAGGCGGCGGGGGAGGTGAACATGGAGGTGGATATGGCGGCGGTGCCG
 
. : . : . : . : . : . :
rJMFF003C16+ GAGGTGGTGAAGGTGGTNGNCATGGTGGGGGCTACNCCCCATGAATATATACCCAAAAGG
rJMFF007J10+ GAGGTGGTGAAGGTGGTGGACATGGTGGGGGCTACGCCCCATGAATATATACCCAAAAGG
rJMFF034N22+ GAGGTGGTGAAGGTGGTGGACATGGTGGGGGCTACGCCCCATGAATATATACCCAAAAGG
                      ____________________________________________________________
consensus GAGGTGGTGAAGGTGGTGGACATGGTGGGGGCTACGCCCCATGAATATATACCCAAAAGG
 
. : . : . : . : . : . :
rJMFF003C16+ GGATATGATTACTCTTCTTACATATACACCGGCCGCATATAATTAAAATAAGTAAATGCA
rJMFF007J10+ GGATATGATTACTCTTCTTACATATACACCGGCCGCATATAATTAAAATAAGTAAATGCA
rJMFF034N22+ GGATATGATTACTCTTCTTACATATACACCGGCCGCATATAATTAAAATAAGTAAATGCA
                      ____________________________________________________________
consensus GGATATGATTACTCTTCTTACATATACACCGGCCGCATATAATTAAAATAAGTAAATGCA
 
. : . : . : . : . : . :
rJMFF003C16+ TGTAAGATATGTGTAAGAAGATGGTTATTATGAAAAGTAATTAATTAAGCAGAAGCATGC
rJMFF007J10+ TGTAAGATATGTGTAAGAAGATGGTTATTATGAAAAGTAATTAATTAAGCAGAAGCATGC
rJMFF034N22+ TGTAAGATATGTGTAAGAAGATGGTTATTATGAAAAGTAATTAATTAAGCAGAAGCATGC
                      ____________________________________________________________
consensus TGTAAGATATGTGTAAGAAGATGGTTATTATGAAAAGTAATTAATTAAGCAGAAGCATGC
 
. : . : . : . : . : . :
rJMFF003C16+ AGCAATGCAAGCTAAGGGCTGCACATGCATGCATATATGTATTAATG
rJMFF007J10+ AGCAATGCAAGCTAAGGGCTGCACATGCATGCATATATGTATTAATGTTTCTTATACA
rJMFF034N22+ AGCAATGCAAGCTAAGGGCTGCACATGCATGCATATATGTATTAATGTTTCTTATACATA
                      ____________________________________________________________
consensus AGCAATGCAAGCTAAGGGCTGCACATGCATGCATATATGTATTAATGTTTCTTATACATA