Previous Contig 009835:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034M16Sequence510003433 (8)gb:AY341252_16007322e-15Nicotiana tabacum stigma/style ABC transporter (NtWBC1) mRNA, partial cds.649009835 (5)gb:AY496971_16091433e-94Nicotiana tabacum WBC1 ABC transporter (NtWBC1) mRNA, partial cds.
JMFF043P14Sequence632003433 (8)gb:AY341252_16007322e-32Nicotiana tabacum stigma/style ABC transporter (NtWBC1) mRNA, partial cds.465009835 (5)gb:AY496971_16091431e-75Nicotiana tabacum WBC1 ABC transporter (NtWBC1) mRNA, partial cds.
JMFN008A24Sequence615009835 (5)gb:AY341251_16007312e-85Nicotiana tabacum stigma/style ABC transporter (NtWBC1) gene, complete cds.
JMFN043D19Sequence597009835 (5)gb:AY341251_16007313e-80Nicotiana tabacum stigma/style ABC transporter (NtWBC1) gene, complete cds.
JMSF035J06Sequence707003433 (8)gb:AY341251_16007312e-41Nicotiana tabacum stigma/style ABC transporter (NtWBC1) gene, complete cds.706009835 (5)gb:AY341251_1600731e-109Nicotiana tabacum stigma/style ABC transporter (NtWBC1) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008A24- CTGAAGGAAGCCATCAGCGCC
                      ____________________________________________________________
consensus CTGAAGGAAGCCATCAGCGCC
 
. : . : . : . : . : . :
JMFN008A24- AGTATTTCCCGGGGAAAACTAGTCCCCGGAGCGACGAATGACGCCAGCACTACGTCACTG
                      ____________________________________________________________
consensus AGTATTTCCCGGGGAAAACTAGTCCCCGGAGCGACGAATGACGCCAGCACTACGTCACTG
 
. : . : . : . : . : . :
JMFN008A24- GTCCCCACTTTCGCCAACCCGTTCTGGACGGAAATGGTGGTTCTCTCCAAACGGTCCTTT
                      ____________________________________________________________
consensus GTCCCCACTTTCGCCAACCCGTTCTGGACGGAAATGGTGGTTCTCTCCAAACGGTCCTTT
 
. : . : . : . : . : . :
JMFN008A24- AAAAACTCGAGCCGGATGCCCGCACTTTTCGGGACACGGTTAGGAGCGGTTATGGTGACC
                      ____________________________________________________________
consensus AAAAACTCGAGCCGGATGCCCGCACTTTTCGGGACACGGTTAGGAGCGGTTATGGTGACC
 
. : . : . : . : . : . :
JMFN008A24- GGATTCATCCTAGCTACAATGTTCTGGCGACTCGATAATTCCCCCAAAGGAGTACAGGAA
                      ____________________________________________________________
consensus GGATTCATCCTAGCTACAATGTTCTGGCGACTCGATAATTCCCCCAAAGGAGTACAGGAA
 
. : . : . : . : . : . :
JMFN008A24- CGGCTAGGATTCTTCGCCTTCGCGATGTCCACAACCTTCTACACGTGCGCCGACGCGCTG
JMFN043D19- GCTG
rJMSF035J06+ GCTG
                      ____________________________________________________________
consensus CGGCTAGGATTCTTCGCCTTCGCGATGTCCACAACCTTCTACACGTGCGCCGACGCGCTG
 
. : . : . : . : . : . :
JMFN008A24- CCGGTGTTCATCCAGGAACGGTATATTTTCCTGAGAGAAACGGCGTACAACGCCTACCGG
JMFN043D19- CCGGTGTTCATCCAGGAACGGTATATTTTCCTGAGAGAAACGGCGTACAACGCCTACCGG
rJMSF035J06+ CCGGTGTTCATCCAGGAACGGTATATTTTCCTGAGAGAAACGGCGTACAACGCCTACCGG
                      ____________________________________________________________
consensus CCGGTGTTCATCCAGGAACGGTATATTTTCCTGAGAGAAACGGCGTACAACGCCTACCGG
 
. : . : . : . : . : . :
JMFN008A24- AGATCCTCCTACTGTCTCTCCCACGCGCTGGTCTCCTTCCCGTCGCTAGTCTTCCTCGCG
JMFN043D19- AGATCCTCCTACTGTCTCTCCCACGCGCTGGTCTCCTTCCCGTCGCTAGTCTTCCTCGCG
rJMSF035J06+ AGATCCTCCTACTGTCTCTCCCACGCGCTGGTCTCCTTCCCGTCGCTAGTCTTCCTCGCG
                      ____________________________________________________________
consensus AGATCCTCCTACTGTCTCTCCCACGCGCTGGTCTCCTTCCCGTCGCTAGTCTTCCTCGCG
 
. : . : . : . : . : . :
JMFN008A24- TTCGCCTTCGCGGCGCTGACTTTCTGGGCGGTAGGGCTCGACGGCGGAACTTCTGGATTC
JMFN043D19- TTCGCCTTCGCGGCGCTGACTTTCTGGGCGGTAGGGCTCGACGGCGGAACTTCTGGATTC
rJMSF035J06+ TTCGCCTTCGCGGCGCTGACTTTCTGGGCGGTAGGGCTCGACGGCGGAACTTCTGGATTC
rJMFF034M16+ GGCGCTGACTTTCTGGGCGGTAGGGCTCGACGGCGGAACTTCTGGATTC
                      ____________________________________________________________
consensus TTCGCCTTCGCGGCGCTGACTTTCTGGGCGGTAGGGCTCGACGGCGGAACTTCTGGATTC
 
. : . : . : . : . : . :
JMFN008A24- TTCTTCTACTTCGGCATCATCGTGGCCTCATTCTGGGCCGGAAACTCCTTCGTCACGTTC
JMFN043D19- TTCTTCTACTTCGGCATCATCGTGGCCTCATTCTGGGCCGGAAACTCCTTCGTCACGTTC
rJMSF035J06+ TTCTTCTACTTCGGCATCATCGTGGCCTCATTCTGGGCCGGAAACTCCTTCGTCACGTTC
rJMFF034M16+ TTCTTCTACTTCGGCATCATCGTGGCCTCATTCTGGGCCGGAAACTCCTTCGTCACGTTC
                      ____________________________________________________________
consensus TTCTTCTACTTCGGCATCATCGTGGCCTCATTCTGGGCCGGAAACTCCTTCGTCACGTTC
 
. : . : . : . : . : . :
JMFN008A24- CTCTCCGGCGTCGTCCCGCACGTGATGCTCGGATACACCATGGTCGTCGCCATC
JMFN043D19- CTCTCCGGCGTCGTCCCGCACGTGATGCTCGGATACACCATCGTCGTCGCCATCCTCGCC
rJMSF035J06+ CTCTCCGGCGTCGTCCCGCACGTGATGCTCGGATACACCATCGTCGTCGCCATCCTCGCC
rJMFF043P14+ TCCCGCACGTGATGCTCGGATACACCATCGTCGTCGCCATCCTCGCC
rJMFF034M16+ CTCTCCGGCGTCGTCCCGCACGTGATGCTCGGATACACCATCGTCGTCGCCATCCTCGCC
                      ____________________________________________________________
consensus CTCTCCGGCGTCGTCCCGCACGTGATGCTCGGATACACCATCGTCGTCGCCATCCTCGCC
 
. : . : . : . : . : . :
JMFN043D19- TACTTCCTCCTCTTCTCCGGCTTCTTCATGAACCGCGACCGGATTCCGCCGTACTGGATC
rJMSF035J06+ TACTTCCTCCTCTTCTCCGGCTTCTTCATGAACCGCGACCGGATTCCGCCGTACTGGATC
rJMFF043P14+ TACTTCCTCCTCTTCTCCGGCTTCTTCATGAACCGCGACCGGATTCCGCCGTACTGGATC
rJMFF034M16+ TACTTCCTCCTCTTCTCCGGCTTCTTCATGAACCGCGACCGGATTCCGCCGTACTGGATC
                      ____________________________________________________________
consensus TACTTCCTCCTCTTCTCCGGCTTCTTCATGAACCGCGACCGGATTCCGCCGTACTGGATC
 
. : . : . : . : . : . :
JMFN043D19- TGGTTCCACTATCTCTCCCTCGTCAAATACCCCTACGAGGCCGTGCTTCAGAACGAATTC
rJMSF035J06+ TGGTTCCACTATCTCTCCCTCGTCAAATACCCCTACGAGGCCGTGCTTCAGAACGAATTC
rJMFF043P14+ TGGTTCCACTATCTCTCCCTCGTCAAATACCCCTACGAGGCCGTGCTTCAGAACGAATTC
rJMFF034M16+ TGGTTCCACTATCTCTCCCTCGTCAAATACCCCTACGAGGCCGTGCTTCAGAACGAATTC
                      ____________________________________________________________
consensus TGGTTCCACTATCTCTCCCTCGTCAAATACCCCTACGAGGCCGTGCTTCAGAACGAATTC
 
. : . : . : . : . : . :
JMFN043D19- GACGATCCGACCAAATGCTTCGTCCGGGGGATCCAAATGTTCGACAACTCGCCGCTGAGC
rJMSF035J06+ GACGATCCGACCAAATGCTTCGTCCGGGGGATCCAAATGTTCGACAACTCGCCGCTGAGC
rJMFF043P14+ GACGATCCGACCAAATGCTTCGTCCGGGGGATCCAAATGTTCGACAACTCGCCGCTGAGC
rJMFF034M16+ GACGATCCGACCAAATGCTTCGTCCGGGGGATCCAAATGTTCGACAACTCGCCGCTGAGC
                      ____________________________________________________________
consensus GACGATCCGACCAAATGCTTCGTCCGGGGGATCCAAATGTTCGACAACTCGCCGCTGAGC
 
. : . : . : . : . : . :
JMFN043D19- GCGGTGTCGACGCCGCTCAAGGAGCGGCTGCTGAGCACGAT-AGCAGCACGCTGAACATT
rJMSF035J06+ GCGGTGTCGACGCCGCTCAAGGAGCGGCTGCTGAGCACGATGAGCAGCACGCTGAACATT
rJMFF043P14+ GCGGTGTCGACGCCGCTCAAGGAGCGGCTGCTGAGCACGATGAGCAGCACGCTGAACATT
rJMFF034M16+ GCGGTGTCGACGCCGCTCAAGGAGCGGCTGCTGAGCACGATGAGCAGCACGCTGAACATT
                      ____________________________________________________________
consensus GCGGTGTCGACGCCGCTCAAGGAGCGGCTGCTGAGCACGATGAGCAGCACGCTGAACATT
 
. : . : . : . : . : . :
JMFN043D19- AAGATCACGGCGACCACGTGCGTCACCACCGGCGCCG
rJMSF035J06+ AAGATCACGGCGACCACGTGCGTCACCACCGGCGCCGACATTCTGGCGCAGCAGGGAGTG
rJMFF043P14+ AAGATCACGGCGACCACGTGCGTCACCACCGGCGCCGACATTCTGGCGCAGCAGGGAGTG
rJMFF034M16+ AAGATCACGGCGACCACGTGCGTCACCACCGGCGCCGACATTCTGGCGCAGCAGGGAGTG
                      ____________________________________________________________
consensus AAGATCACGGCGACCACGTGCGTCACCACCGGCGCCGACATTCTGGCGCAGCAGGGAGTG
 
. : . : . : . : . : . :
rJMSF035J06+ ACGGACCTCAGCAAGTGGGGGTGCTTGTGGGTGACGATTGCATGGGGATTTTTCTTTAGG
rJMFF043P14+ ACGGACCTCAGCAAGTGGGGGTGCTTGTGGGTGACGATTGCATGGGGATTTTTCTTTAGG
rJMFF034M16+ ACGGACCTCAGCAAGTGGGGGTGCTTGTGGGTGACGATTGCATGGGGATTTTTCTTTAGG
                      ____________________________________________________________
consensus ACGGACCTCAGCAAGTGGGGGTGCTTGTGGGTGACGATTGCATGGGGATTTTTCTTTAGG
 
. : . : . : . : . : . :
rJMSF035J06+ ATTTTATTTTATTTCTGCCTG
rJMFF043P14+ ATTTTATTTTATTTCTGCCTGTTACTGGGAAGCAAGAACAAGAGAAGGTAATAAGTCC
rJMFF034M16+ ATTTTATTTTATTTCTGCCTGTTACTGGGAAGCAAGAACAAGAGAAGGTAATAAGTCCAA
                      ____________________________________________________________
consensus ATTTTATTTTATTTCTGCCTGTTACTGGGAAGCAAGAACAAGAGAAGGTAATAAGTCCAA
 
. : . : . : . : . : . :
rJMFF034M16+ AAAAAGAAAAAAACACTACTATACGGAGTATTAATTACTCACTGTAAAACTAAAGTTTCT
                      ____________________________________________________________
consensus AAAAAGAAAAAAACACTACTATACGGAGTATTAATTACTCACTGTAAAACTAAAGTTTCT