Previous Contig 009832:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034M11Sequence491006549 (5)gb:AY830138_16293381e-07Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.734009832 (4)
JMSF021P15Sequence685006549 (5)gb:AY830138_16293380.003Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.720009832 (4)
JMSF022K13Sequence671006549 (5)gb:AY830138_16293382e-07Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.741009832 (4)gb:AX076881_14606692e-05Sequence 2 from Patent WO0107635.>gb:AX076883_1460670 Sequence 4 from Patent WO0
JMSF028O10Sequence625006549 (5)gb:AY830138_16293384e-07Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.615009832 (4)gb:SAC249448_17046705e-16Solanum acaule Rx2.ac15 gene for NBS-LRR protein, exons 1-3.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028O10+ GTNAGCTGTAAAAATCTTATGAAGTTGAGCTNTAGGTGTGTGAGCTTTGAGGTG
                      ____________________________________________________________
consensus GTNAGCTGTAAAAATCTTATGAAGTTGAGCTNTAGGTGTGTGAGCTTTGAGGTG
 
. : . : . : . : . : . :
rJMSF028O10+ AAGACAATTAATAGTTTTAGCAAGTTGCCTAAACTTGAGGTGCTAGTGCTAAGCAAGTGT
                      ____________________________________________________________
consensus AAGACAATTAATAGTTTTAGCAAGTTGCCTAAACTTGAGGTGCTAGTGCTAAGCAAGTGT
 
. : . : . : . : . : . :
rJMSF028O10+ GACTGGATCGGTGGAGCGTGGGAACTACTTGAAAAGGAGAGTTTTGACCAGTTAATTTAT
                      ____________________________________________________________
consensus GACTGGATCGGTGGAGCGTGGGAACTACTTGAAAAGGAGAGTTTTGACCAGTTAATTTAT
 
. : . : . : . : . : . :
rJMSF028O10+ TTGGAAATTAATACGAGTAATTTTCTTGAGCGTTGGGAAGCAAGTGCTTCAAATTTTCCG
                      ____________________________________________________________
consensus TTGGAAATTAATACGAGTAATTTTCTTGAGCGTTGGGAAGCAAGTGCTTCAAATTTTCCG
 
. : . : . : . : . : . :
rJMSF028O10+ AAACTTGAGCGTCTAGTCCTTGATTGGTGCGAAGTATTGGAAAAGATCCCAGTTGGGTTT
rJMSF022K13+ AAAGATTCCAGTTGAGTTT
                      ____________________________________________________________
consensus AAACTTGAGCGTCTAGTCCTTGATTGGTGCGAAGTATTGGAAAAGATTCCAGTTGGGTTT
 
. : . : . : . : . : . :
rJMSF028O10+ GCAGAAATTCCAAATTTGAAGTCAATCAAAGTGTATGAATGTCTTCAGTCTGTAGTGGAT
rJMSF022K13+ GCAGAAATTCCAAATTTGAAGTCAATTGAATTGGATTACTGTCTTCCTTCTGCGGTGGAT
                      ____________________________________________________________
consensus GCAGAAATTCCAAATTTGAAGTCAATTGAATTGTATTACTGTCTTCCTTCTGTGGTGGAT
 
. : . : . : . : . : . :
rJMSF028O10+ TCTGCCAAGGAAATTCAAAGAGAGCAACATGAGCAAGGAAATGATAATATGGTTGTCATT
rJMSF022K13+ TCTGCCAAGAAAATTCAAAAAGAGCAACATGAGCAAGGAAATGAAAATATGGTTGTCATT
                      ____________________________________________________________
consensus TCTGCCAAGGAAATTCAAAGAGAGCAACATGAGCAAGGAAATGATAATATGGTTGTCATT
 
. : . : . : . : . : . :
rJMSF028O10+ GA
rJMSF022K13+ GAGGAACACACACTACAGTGATTCATGGCAGCCTAGCTCTCGCAATGATAAACATATTAG
                      ____________________________________________________________
consensus GAGGAACACACACTACAGTGATTCATGGCAGCCTAGCTCTCGCAATGATAAACATATTAG
 
. : . : . : . : . : . :
rJMSF021P15+ AAAGCAAGGTGACATACAGCTCCCACAGTACACTCTTAGCTC
rJMSF022K13+ AGTTGATCCATATTTCAAAAAGCAAGGTGACATACAGCTCCCACAGTACACTCTTAGCTC
rJMFF034M11+ AAAGCAAGGTGACATACAGCTCCCACAGTACACTCTTAGCTC
                      ____________________________________________________________
consensus AGTTGATCCATATTTCAAAAAGCAAGGTGACATACAGCTCCCACAGTACACTCTTAGCTC
 
. : . : . : . : . : . :
rJMSF021P15+ CAATTCAATGGCTCCGATATCTTGGACACCGCCACCCTAGCTTGTAAAATCCAACGCTTT
rJMSF022K13+ CAATTCAATGGCTCCGATATCTTGGACACCGCCACCCTAGCTTGTAAAATCCAACGCTTT
rJMFF034M11+ CAATTCAATGGCTCCGATATCTTGGACACCGCCACCCTAGCTTGTAAAATCCAACGCTTT
                      ____________________________________________________________
consensus CAATTCAATGGCTCCGATATCTTGGACACCGCCACCCTAGCTTGTAAAATCCAACGCTTT
 
. : . : . : . : . : . :
rJMSF021P15+ TCATCGTTAATGATTCGGCTGGTTTCGACCAGGTAGTAAGTTCTCCTTCATAAATCTGGG
rJMSF022K13+ TCATCGTTAATGATTCGGCTGGTTTCGACCAGGTAGTAAGTTCTCCTTCATAAATCTGGG
rJMFF034M11+ TCATCGTTAATGATTCGGCTGGTTTCGACCAGGTAGTAAGTTCTCCTTCATAAATCTGGG
                      ____________________________________________________________
consensus TCATCGTTAATGATTCGGCTGGTTTCGACCAGGTAGTAAGTTCTCCTTCATAAATCTGGG
 
. : . : . : . : . : . :
rJMSF021P15+ CACTTTAATTTGTTGTAGCTTGTTATGGGAAGTTTGCTTAGAACTGTGATCCGGGTTTAG
rJMSF022K13+ CACTTTAATTTGTTGTAGCTTGTTATGGGAAGTTTGCTTAGAACTGTGATCCGGGTTTAG
rJMFF034M11+ CACTTTAATTTGTTGTAGCTTGTTATGGGAAGTTTGCTTAGAACTGTGATCCGGGTTTAG
                      ____________________________________________________________
consensus CACTTTAATTTGTTGTAGCTTGTTATGGGAAGTTTGCTTAGAACTGTGATCCGGGTTTAG
 
. : . : . : . : . : . :
rJMSF021P15+ CCAAAACTATATATTGCTTGTTGCGAGGCTTTATCATGGCTTAAATGGAGATGTATTAAT
rJMSF022K13+ CCAAAACTATATATTGCTTGTTGCGAGGCTTTATCATGGCTTAAATGGAGATGTATTAAT
rJMFF034M11+ CCAAAACTATATATTGCTTGTTGCGAGGCTTTATCATGGCTTAAATGGAGATGTATTAAT
                      ____________________________________________________________
consensus CCAAAACTATATATTGCTTGTTGCGAGGCTTTATCATGGCTTAAATGGAGATGTATTAAT
 
. : . : . : . : . : . :
rJMSF021P15+ AACGTCATCCTAGAGTTGAGACAGACAATTTTAAATTTTGTTAATGTTTCTCATGATTAT
rJMSF022K13+ AACGTCATCCTAGAGTTGAGACAGACAATTTTAAATTTTGTTAATGTTTCTCATGATTAT
rJMFF034M11+ AACGTCATCCTAGAGTTGAGACAGACAATTTTAAATTTTGTTAATGTTTCTCATGATTAT
                      ____________________________________________________________
consensus AACGTCATCCTAGAGTTGAGACAGACAATTTTAAATTTTGTTAATGTTTCTCATGATTAT
 
. : . : . : . : . : . :
rJMSF021P15+ TCAACTTTAGTTATTGACCACTTTAGATTCTACTATTGGGGATGTTTTAGTTCGTCATGT
rJMSF022K13+ TCAACTTTAGTTATTGACCACTTTAGATTCTACTATTGGGGATGTTTTAGTTCGTCATGT
rJMFF034M11+ TCAACTTTAGTTATTGACCACTTTAGATTCTACTATTGGGGATGTTTTAGTTCGTCATGT
                      ____________________________________________________________
consensus TCAACTTTAGTTATTGACCACTTTAGATTCTACTATTGGGGATGTTTTAGTTCGTCATGT
 
. : . : . : . : . : . :
rJMSF021P15+ TGGTAAATCATCAAATCATTCTGCTCATGCTTTGACACGGGTTTTAGGTTCTCAAGCTAG
rJMSF022K13+ TGGTAAATCATCAAATCATTCTGCTCATGCTTTGACACGGGTTTTAGGTTCTCAAGCTAG
rJMFF034M11+ TGGTAAATCATCAAATCATTCTGCTCATGCTTTGACACGGGTTTTAGGTTCTCAAGCTAG
                      ____________________________________________________________
consensus TGGTAAATCATCAAATCATTCTGCTCATGCTTTGACACGGGTTTTAGGTTCTCAAGCTAG
 
. : . : . : . : . : . :
rJMSF021P15+ TTCGAGGGTGTGGTATTTTAATTCGTAGCCTCTTATTGC
rJMSF022K13+ TTCGAGGGTGTGGTATTTTAATTCGTAGCCTCTTATTGC
rJMFF034M11+ TTCGAGGGTGTGGTATTTTAATTCGTAGCCTCTTATTGCATGTATTCCTGTGTTAAATTC
                      ____________________________________________________________
consensus TTCGAGGGTGTGGTATTTTAATTCGTAGCCTCTTATTGCATGTATTCCTGTGTTAAATTC